Amgen Inc. v. F. Hoffmann-LaRoche LTD et al
Filing
810
DECLARATION re #808 MOTION in Limine To Preclude Amgen Inc. From Making Assertions That Contradict Statements Made in Specifications of Patents-In-Suit (By Kregg T. Brooks) by F. Hoffmann-LaRoche LTD, Roche Diagnostics GmbH, Hoffmann LaRoche Inc.. (Attachments: #1 Exhibit A#2 Exhibit B, Part 1#3 Exhibit B, Part 2#4 Exhibit B, Part 3)(Brooks, Kregg)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 1 of 22
Amgen Inc. v. F. Hoffmann-LaRoche LTD et al
Doc. 810 Att. 2
US005441 868A
United States Patent
Lin
[54] PRODUCTION OF RECOMBINANT ERYTHROPOIETIN I751 Inventor: [73] Assignee: Fu-Kuen Lin, Thousand Oaks, Calif. Kirin-Amgen, Inc., Thousand Oaks, Calif. Oct. 23, 1987
1111
1.151
Patent Number: Date of Patent:
5,441,868
Aug. 15, 1995
4,667,016 5/1987 Lai et al. ............................. 530/397 4,677,195 6/1987 Hewick et al. ...................... 530/397 (List continued o n next page.) F O R E I G N P A T E N T DOCUMENTS 0070685 1/1983 European Pat. Off. . (List continued o n next page.) O T H E R PUBLICATIONS Gething et al, Nature vol. 300 pp. 598-608 Dec. 16, 1982. (List continued on next page.) Primary Examiner-James Martinell Attorney, Agent, or Firm-Marshall, O'Toole, Gerstein, Murray & Borun 1571 ABSTRACT Disclosed are novel polypeptides possessing part o r all of the primary structural conformation and one or more of the biological properties of mammalian erythropoietin ("EPO) which are characterized in preferred forms by being the product of procaryotic o r eucaryotic host expression of an exogenous D N A sequence. Illustratively, genomic DNA, c D N A and manufactured D N A sequences coding for part o r all of the sequence of amino acid residues of E P O o r for analogs thereof are incorporated into autonomously replicating plasmid o r viral vectors employed to transform o r transfect suitable procaryotic o r eucaryotic host cells such as bacteria, yeast o r vertebrate cells in culture. Upon isolation from culture media o r cellular lysates o r fragments, products of expression of the D N A sequences display, e.g., the immunological properties and in vitro and in vivo biological activities of E P O of human o r monkey species origins. Disclosed also are chemically synthesized polypeptides sharing the biochemical and immunological properties of EPO. Also disclosed are improved methods for the detection of specific single stranded polynucleotides in a heterologous cellular o r viral sample prepared from, e.g., D N A present in a plasmid o r viral-bone c D N A o r genomic D N A "library".
5 Claims, 27 Drawing Sheets
[21] Appl. No.: 113,179 [22] Filed:
[63]
Related U.S. Application Data Continuation of Ser. No. 675,298, Nov. 30, 1984, Pat. No. 4,703,008, which is a continuation-in-part of Ser. No. 561,024, Dec. 13, 1983, abandoned, and a continuation-in-part of Ser. No. 582,185, Feb. 21, 1984, abandoned, and Ser. No. 655,841, Sep. 28,1984, abandoned.
[5 11 Int. CI.6 [52] U.S. Cl.
....................... C12P 21/02; C12N 15/27 ................................ 435/69.4; 435/240.1;
..................... 435/70, 69.5, 172.3,
435/69.1, 69.4, 69.6, 240.2, 320.1; 935/50, 13; 536/27, 23.5, 23.51 435/240.2; 536/23.5 1; 935/13
[58] Field of Search
[561
References Cited U.S. P A T E N T DOCUMENTS 3,033,753 5/1962 White et al. ........................ 530/395 3,865,801 2/1975 Chiba et al. ......................... 530/397 4,237,224 12/1980 Cohen et al. ....................... 43Y69.1 4,254,095 3/1981 Fisher et al. .......................... 424/88 4,264,731 4/1981 Shine ................................ 435/91.41 4,273,875 6/198 1 Manis ............................... 435/253.5 4,293,652 10/1981 Cohen .............................. 435/172.3 4,303,650 12/1981 Takezawa et al. .................. 424/545 4,338,397 7/1982 Gilbert et al. ...................... 435/69.1 4,358,535 11/1982 Falkow et al. .......................... 435/5 4,377,513 3/1983 Sugimoto et al. ................... 530/395 4,394,443 7/1983 Weissman et al. ......................435/6 4,397,840 8/1983 Takezawa et al. .................. 530/399 4,399,216 8/1983 Axel et al. ............................... 435/6 4.41 1,994 10/1983 Gilbert et al. ...................... 435/69.7 4,442,205 4/1984 Harner et al. ...................... 435/69.1 4,465,624 8/1984 Chiba et al. ......................... 530/395 4,468,464 8/1984 Cohen et al. ..................... 43W320.1 4,503,151 3/1985 Paddock ............................. 435/69.1 4,558,005 12/1985 Goldwasser et al. .............. 435/7.92 4,558,006 12/1985 Egrie .................................. 435/7.94 4,568,488 2/1986 Lee-Huang ......................... 530/380
Dockets.Justia.com
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 2 of 22
Page 2 U.S. PATENT DOCUMENTS
4,703,008 10/1987 Lin ................................... 435/240.2 4,710,473 12/1987 Morris ............................. 435/320.1 4,757,006 7/1988 Toole et al. ...................... 435/69.6' 4,695,542 9/1987 Yokota et al. ........................ 935/50
0070687 1/1983 0077670 4/1983 0093619 11/1983 01 16446 8/1984 01 17058 8/1984 01 17059 8/1984 01 17060 8/1984 0123294 10/1984 0136490 4/1985 3316297A1 11/1983 3348289C2 1 ]/I983 2085887 5/1982 83/04053 11/1983 85/01961 5/1985 85/03079 7/1985 85/04419 10/1985 86/03520 6/1986
FOREIGN PATENT DOCUMENTS European Pat. Off. .
European Pat. Off. European Pat. Off. European Pat. Off. European Pat. OfE European Pat. Off. European Pat. Off. European Pat. Off. European Pat. OK Germany . Germany . United Kingdom . WIPO . WIPO . WIPO .
.
.
.
. . . . .
WIPO . WIPO .
OTHER PUBLICATIONS Soggs et al. (1981) Proceedings of the National Academy of Sciences, vol. 78, pp. 6613-6617. Abraham et al., "Nucleotide Sequence of a Bovine Clone Encoding the Angiogenic Protein, Basic Fibroblast Growth Factor," Science, 233, 545-548 (Aug. 1, 1986). Adamson, "The Polycythemias: Diagnosis and Treatment," Hosp. Practice, 18(12), 49-57 (Dec. 1983). Aebi et al., "Sequence Requirements for Splicing of Higher Eukaryotic Nuclear Pre-mRNA," Cell, 47, 555-565 (Nov. 21, 1986). Aganval et al., "A General Method for Detection and Characterization of an mRNA using an Oligonuc1eotide Probe," J. BioL Chem., 256, 1023-1028 (Jan. 25, 1981). Anderson et al., "Isolation of a genomic clone for bovine pancreatic trypsin inhibitor by using a unique-sequence synthetic DNA probe," P.N.A.S. (USA), 80, 6838-6842 (Nov. 1983). Baciu et al., "Erythropoietin Interaction with the Mature Red Cell Membrane," Ann. N. Y. Acad. Sci., 414, 66-72 (1983).
Baron et al., "Antibodies against the Chemically Synthesized Genome-Linked Protein of Poliovirus React with Native Virus-Specific Proteins," Cell, 28, 395-404 (Feb. 1982). Beaucage et al., "Deoxynucleoside Phosphoramidites-A new Class of Key Intermediates for Deoxypolynucleotide Synthesis," Tetrahedron Letters, 22(20), 1859-1 862 (1981). Benedum et al., "The primary structure of bovine chromogranin A: a representative of a class of acidic secretory proteins common to a variety of peptidergic cells," EMBO J. 5(7), 1495-1502 (1986). Bennetzen et al., "Codon Selection in Yeast," J. Biol. Chem, 257(6), 3026-3031 (Mar. 25, 1982). Bentley et al., "Human immunoglobulin variable region genes-DNA sequences of two Vk genes and a pseudogene," Nature 288, 730-733 (Dee. 1980). Benton et al., "Screening Agt Recombinant Clones by Hybridization to single Plaques in situ," Science 196, 180-182 (Apr. 8, 1977). Berzofsky et al., "Topographic Antigenic Determinants REcognized by Monoclonal Antibodies to Sperm Whale Myoglobin," J. Biol. Chem. 257(6), 3189-3198 (Mar. 25, 1982). Berzofsky et al., "Properties of Monoclonal Antibodies Specific for Determinants of a Protein Antigen, Myoblobin," J. Biol: Chem. 255(23), 11188-1 1191 (Dec. 10, 1980). Betsholtz et al., %DNA sequence and chromosomal localization of human platelet-derived growth factor A-chain and its expression in tumour cell lines," Nature 320,695-699 (Apr. 24, 1986). Billat et al., "In vitro and In Vivo Regulation of Hepatic Erythropoiesis by Erythropoietin and Glucocorticoids in the Rat Fetus," Exp. Hematol., 10(1), 133-140 (1982). Blattner et al., "Charon Phages: Safer Derivatives of Bacteriophage Lambda for DNA Cloning," Science, 196, 161-169 (Apr. 8, 1977). Bray et al., "Human cDNA clones for four species of Ga-signal transduction protein," P.N.A.S. (USA), 83, 8893-8897 (Dec. 1986). Breslow et al., "Isolation and characterization of cDNA clones for human apolipoprotein A-I," P. N.A.S.(USA), 79, 6861-6865 (Nov.1982). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 3 of 22
Page 3 OTHER PUBLICATIONS Broome et al., "Immunological screening method to detect specific translation products," P.N.A.S. (USA), 75(6), 2746-2749 (Jun. 1978). Canaani et al., "Regulated expression of human interferon 0 1 gene after transduction into cultured mouse and rabbit cells," P.N.A.S. (USA), 79, 5166-5170 (Sep. 1982). ~ h a et al., "Construction and selection of recombinant n plasmids containing full-length complementary DNAs corresponding to rat insulins I and 11," P.N.A.S. (USA), 76(10), 5036-5040 (Oct. 1979). Chia et al., "The construction of cosmid libraries of eukaryotic DNA using the Homer series of vectors," Nucleic Acids Res. 10(8), 2503-2520 (1982). Chiba et a]., "Stabilization of Urinary Erythropoietin," Biochem. and Biophys. Res. Commun., 47(6), 1372-1377 (1972). Chirgwin et al., "Isolation of Biologically Active Ribonucleic Acid from Sources Enriched in Ribonuclease," Biochemistry, 18(24), 5294-5299 (1979). Chisholm, "On the Trail of the Magic Bullet: Monoclonal antibodies promise perfectly targeted chemicals," High Technology, vol. 2(1), 57-63 (Jan. 1983). Chomczynski et a]., "Alkaline Transfer of D N A to Plastic Membrane," Biochem. Biophys. Rex Commun., 122(1), 340-44 (Jul. 18, 1984). Choo et al., "Molecular cloninz of the gene for human , anti-haemophilic factor IX," ~ a t u r e299, 178-180 (Sep. 9, 1982). Choppin et a]., "Characterization of Erythropoietin Produced by IW32 Murine Erythroleukemia Cells," Blood, 64(2), 341-347 (Aug. 1984). Chou et a]., "Prediction of the Secondary Structure of Proteins from their Amino Acid Sequence," Advances in Enzymology, 47, 45-47 (1978). Chou et al., "Empirical Predictions of Protein Conformation," Ann. Rev. Biochem., 47, 251-77 (1978). Chou et al., "Prediction of Protein Conformation," Biochem., 13(2), 222-245 (1974). Christman et al., "Amplification of expression of hepatitis B surface antigen in 3T3 cells cotransfected with a dominant-acting gene and cloned viral DNA," P.N.A.S. 79, 1815-1819 (Mar. 1982). Claus-Walker et al., "Spinal Cord Injury and Serum Erythropoietin," Arch. Phys. Med. Rehabil., 65, 370-374 (Jul. 1984). Collen et al., "Biological Properties of Human Tissue-Type Plasminogen Activator Obtained by Expression of Recombinant D N A in Mammalian Cells." J. of Pharmacology and Exp. Therapeutics, 23 1(1), 146-152 (1984). ~olm.an,"Cells that secrete foreign proteins," TIBS, 435-437 (Dec. 1982). Comb et a]., "Primary structure of the human Met- and Leu-enkephalin precursor and its mRNA," Nature, 295, 663-666 (Feb. 25, 1982). Congote, "Regulation of Fetal Liver Erythropoiesis," J. o Steroid Biochernistly, 3, 423-428 (1977). f Congote, "Extraction from Fetal Bovine Serum of Erythrotropin, an Erythroid Cell-Stimulating Factor," Anal. Biochem., 140, 428-433 (1984). Congote, "Isolation of T w o Biologically Active Peptides, Erythrotropin I and Erythrotropin I1 from Fetal Calf Intestine," Biochem. Biophys. Res. Comm., 115(2), 477-483 (Sep. 15, 1983). Congote et al., "The Erythrotropins, New Erythroid Cell Stimulating Factors Extractd From Human and Bovine Fetal Tissues," Abstract 364, Proceedings 7th International Congress of Endocrinology (Quebec City, Quebec, Jul. 1-7, 1984). Contrera et al., "Extraction of erythropoietin from Kidneys of Hypoxic and Phenylhydrazine-treated rats," Blood, 25(5), 809-816 (May 1965). Costantini et a t , "Introduction of a Rabbit Betaglobin Gene into the Mouse Germ Line," Nature, 294, 92-94 (Nov. 5, 1981). Costantini et al., "Gene Transfer into the Mouse Germ-Line," J. CeN Physiol. Supp. I, 219-226 (1982). Cotes et a]., "Changes in serum immunoreactive erythropoietin during the menstrual cycle and normal pregnancy," Brit. J. Obster. Gynaecol., 90, 304-3 11 (Apr. 1983). cotes et al., "Bio-Assay of Erythropoietin in Mice made Polycythaemic by Exposure to Air at a Reduced Pressure," Nature, 191, 1065-1067 (Sep. 9, 1961). Dainiak et al., "Mechanisms of Abnormal Erythropoiesis in Malignancy," Cancer, 51(6), 1101-1 106 (1983). Das et a]., "Use of synthetic oligonucleotide probes complementary to genes for human HLA-DRa and fi as extension primers for the isolation of 5'-specific genomic clones," l? N.A.S. (USA), 80, 1531-1535 (Mar. 1983). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 4 of 22
Page 4 OTHER PUBLICATIONS Davis et al., "A Manual for Genetic Engineering, Advanced Bacterial Genetics", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1983), pp. 55-58 & 174- 176. Derynck et al., "Human transforming growth factor-0 complementary DNA sequence and expression in normal and transformed cells," Nature, 316, 701-705 (Aug. 22, 1985). Derynck et al., "Human Transforming Growth Factor-a: Precursor Structure and Expression in E. coli," Cell, 38, 287-297 (Aug. 1984). Dessypris et al., "Effect of pure erythropoietin on DNA-synthesis by human marrow day 15 erythroid burst forming units in short-term liquid culture," Brit. J. HaematoL, 56, 295-306 (1984). Docherty et a]., "Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid-potentiating activity," Nature, 318, 66-69 (Nov. 7, 1985). Dordal et al., "The Role of Carbohydrate in Erythropoietin Action," Endocrinology, 116(6), 2293-2299 (1985). Dressman et al., "Antibody to hepatitis B surface antigen after a single inoculation of uncoupled synthetic HBsAg peptides," Nature, 295, 158-160 (Jan. 14, 1982). Dunn et al., "Use of a computer model in the understanding of erythropoietic control mechanisms," Chemical Abstracts, 9 1, 190417r (1979). Dunn, "Current Concepts in Erythropoiesis", John Wiley & Sons, Chichester, England, 1983. Dunn et al., "Serum erythropoietin titers during prolonged bedrest; relevance to the anaemia of space flight," Eur. J. Appln. Physiol., 52, 178-182 (1984). Dunn et al., "Erythropoietin Bioassays Using Fetal Mouse Liver Cells: Validations and Technical Improvements," Exp. Hematol., 11(7), 590-600 (Aug. 1983). ~ d k a n al., "A Protein Sequentator," Eur. J. Bioet chem. 1, 80-91 (1967). Emmanouel et al., "Metabolism of pure human erythropoietin in the rat," Am. 3. Physiol., 247(1 Pt 2), F168-76 (1984). Eschbach et al., "Correction by Erythropoietin (EPO) Therapy of the Anemia of chronic Renal Failure (CRP) in Sheep," Clin. Res. 29(2), 518A (1981). Eschbach et al., "The Anemia of Chronic Renal Failure in Sheep," J. Clin. Invest., 74(2), 434-441 (Aug. 1984). Espada et al., "Purification of Human Urinary Erythropoietin," Fed. Proc. 41, 1159 (1982). Farber et al., "Translation of mRNA from human kidneys into biologically active erythropoietin following microinjection into xenopus iaevis oocytes," 3. Lab. Clin. Med., 102, 681 abstract (Nov. 1983). Farber et al., "Translation of mRNA from Anemic Baboon Kidney into Biologically Active Erythropoietin," Exp. Hematol., 11, Supp. 14, Abstract 101 (1983). Farber, "Translation of RNA from Human Kidneys into Biologically Active Erythropoietin Following Microinjection into Xenopus Laevis Oocytes," Clin. Res., 31(4), 769A (Nov. 1983). Farber et al., "Translation of mRNA from Human Kidneys into Biologically Active Erythropoietin Following Microinjection into Xenopus Laevis Oocytes," Blood, 62(5), Supp. No. 1, Abstract 392, 122a (1983). Fiddes et al., "The Gene Encoding the Common Alpha Subunit of the Four Human Glycoprotein Hormones," J. Mol. & App. Genetics, 1, 3-18 (1981). Finch, "Erythropoiesis, Erythropoietin, and Iron," Blood, 60(6), 1241-1246 (Dec. 1982). Fisher et al., "Cooperative Erythropoietic Assay of Several Steroid Metabolites in Polycythemic Mice," Steroids, 30(6), 833-845 (Dec. 1977). Fisher, "Erythropoietin: Pharmacology, Biogenesis and Control of Production," Pharmacological Review, 24(3), 459-508 (1972). Fisher, "Control of Erythropoietin Production," Proc. Soc. Exp. Biol. & Med. 173, 289-305 (1983). Fisher et a]., "Effects of testosterone, cobalt & hypoxia on erythropoietin production in the isolated perfused dog kidney," Ann. N. Y. Acad. Sci., 75-87 (1967). Garcia et a]., "Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings," J. Lab. Clin. Med., 99,624635 (May 1982). Garcia et al., "Radioimmunoassay of Erythropoietin," Blood Cells 5, 405-419 (1979). Garcia et al., "Immunological Neutralization of Various Erythropoietins," Proc. Soc. Exptl. Biol. Med.. 112, 712-714 (1963). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 5 of 22
Page 5 OTHER PUBLICATIONS Gasser et a]., "Expression of abbbreviated mouse dihydrofolate reductase genes in cultured hamster cells," P.N.A.S. (USA), 79, 6522-6526 (Nov. 1982). Gene Screen, New England Nuclear, Catalog No. NEF-972. Gibson et a]., "An Evaluation of Serum Erythropoietin Estimation By a Hemagglutination Inhibition assay in the Differential Diagnosis of Polycythemia," Pathology, 16, 155-156 (Apr. 1984). Gluzman, "SV4eTransformed Simian Cells Support the Replication of Early SV40 Mutants," CeN 23, 175-182 (Jan. 1981). Goeddel et al., "Synthesis of human fibroblast interferon by E. coli," Nucleic Acids Rex, 8(18), 4057-4074 (1980). Goeddel et al., "Human leukocyte Interferon Produced by E. coli is biologically active," Nature, 287:411-416 (Oct. 2, 1980). Goldwasser et al., "Erythropoietin: Assay and Study of Its Mode of Action," Meth. in EnzymoL, 37, 109-121 (1975). Goldwasser, "From Protein to Gene to Protein: The Molecular Biology of Erythropoietin," Am. J , ofKidney Diseases, 18(4) Suppl. 1, 10-13 (Oct. 1991). Goldwasser, "BiochemicaI Control of Erythroid Development", Current Topics in Developmental Biology, ed. A. Monroy and A. A. Noscona, 173-21 1, Academic Press, N.Y. (1966). Goldwasser et a]., "The Molecular Weight of Sheep Plasma Erythropoietin," J. of Biol. Chem., 247(16), 5159-60 (Aug. 25, 1972). Goldwasser et al., "Progress in the purification of erythropoietin," Ann. N. Y. Acad. Sci., 149:49-53 (1968). Goldwasser et a]., "On the mechanism of Erythropoietin-induced Differentiation," J. of Biol. Chem., 249(13), 4202-4206 ( J u ~ 10, 1974). . Goldwasser et al., "Purification of Erythropoietin," P.N.A.S. (USA), 68(4), 697-698 (Apr. 1971). Goldwasser et a]., "Further purification of sheep plasma erythropoietin", Bioch. Biophys. Acta, 64, 487-496 (1962). Goldwasser, "Some Thoughts on the Nature of Erythropoietin-Responsive Cells," J. Cell. Physiol., 110 (Supp. I ) , 133-135 (1982). Goldwasser et a]., "An Assay for Erythropoietin in Vitro at the Milliunit Level," Endocrinology, 97(2), 3 15-323 (Aug. 1975). Goldwasser et a]., "Erythropoietin and the differentiation of red blood cells," Fed. Proc. 34, 2285-2292 (Dec. 1975). Goochee et a]., "Environmental Effects on Protein Glycosylation," Biotechnology, 8, 421-427 (May 1990). Goochee et a]., "The Oligosaccharides of Glycoproteins: Bioprocess Factors Affecting Oligosaccharide Structure and their Effect on Glycoprotein Properties," Biotechnology, 9, 1347-1 555 (Dec. 1991). Goodman et a]., "Cloning of Homone Genes from a Mixture of cDNA Molecules," Meth. in Enzymol. 68, 75-90 (1979). Gordon et al., "A plasma extract with erythropoietic activity," Proc. SOC. Expt. Biol. Med., 86255-258 (1954). Goto et a]., "Production of Recombinant Human Erythropoietin in Mammalian Cells: Host-Cell Dependency of the Biological Activity of the Cloned Glycoprotein," Bio/Tech. 6, 67-71 (Jan. 1988). Gough et a]., "Immunoprecipitation of Specific Polysomes Using Staphylococcus aureus: Purification of the Immunoglobulin-Chain Messenger RNA from the Mouse Myeloma MPCI 1," Biochemistry 17(25), 5560-5566 (1978). Gouy et a]., "Codon Usage in Bacteria: Correlation with Gene Expressivity," Nucleic Acids Res. 10, 7055-7074 (1982). Graham et al., "A New Technique for the Assay of Infectivity of Human Adenovirus 5 DNA," Virology 52, 456-467 (1973). Grantham et al., "Codon catalog usage is a genome strategy modulated for gene expressivity," Nucleic Acids Res. 9, r43-74 (1981). Gray et al., "Pseudomonas Aeruginosa Secretes and Correctly Processes Human Growth Hormone," Biotechnology, 2, 161-165 (Feb. 1984). Gray et a]., "Expression of human immune interferon cDNA in E. coli and monkey cells," Nature, 295, 503-508 (Feb. 11, 1982). Green et al., "Immunogenic Structure of the Influenza Virus Hemagglutinin," Cell, 28, 477-487 (Mar. 1982). Greenwood et a]., "The Preparation of '3'1-Labelled Human Growth Hormone of High Specific Radioactivity," Biochem J., 89, 114-123 (1963). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 6 of 22
5,441,868
Page 6 OTHER PUBLICATIONS Grimaldi et al., "Interspersed repeated sequences in the African green monkey genome that are homologous to the human Alu family," Nucleic Acid Research, 9(21), 5553-5568 (1981). Groffen et a1 "Isolation of Human Oncogene Sequences (v-fes Homolog) from a Cosmid Library," Science, 216, 1136-1138 (Jun. 4, 1982). Grundmann et al., "Characterization of cDNA coding for human factor XIIIa," P.N.A.S. (USA), 83,8024-8028 (Nov. 1986). Grunstein et al., "Colony Hybridization," Meth. in Enzym. 68, 379-389 (1979). Grunstein et al., "Colony hybridization: A method for the isolation of cloned DNAs that contain a specific gene," P.N.A.S. USA), 72(10), 3961-3965 (Oct. 1975). Gruss et al., "Expression of simian virus 40-rat preproinsulin recombinants in monkey kidney cells: Use of preproinsulin RNA processing signals," P. N.A.S. (USA), 78(1), 133-137 (Jan. 1981). Gubler et a]., "A simple and very efficient method for generting cDNA libraries," Gene 25, 263-269 (1983). Haddy, "Erythropoietin in sickle cell disease," Am. Jour. Ped. Hematol./Oncol., q2), I9 I- 196 (Summer 1982). Haga et a]., "Plasma Erythropoietin Concentrations During the Erly Anemia of Prematurity," Acra. Pediatr. Scand., 72, 827-831 (1983). Hagiwara et a]., "Erythropoietin Production in a Primary Culture of Human Renal Carcinoma Cells Maintained in Nude Mice," Blood, 63(4), 828-835 (Apr. 1984). Hamer et al., "Expression of the chromosomal mouse BmOJ-globin gene cloned in SV40," Nature, 281, 35-40 (Sep. 6, 1979). Harner et al., "A Mouse Globin Gene Promoter is Functional in SV40," Cell, 21, 697-708 (Oct. 1980). Hammond et al., "Production, Utilization and Excretion of Erythropoietin: I. Chronic Anemias. 11. Aplastic Crisis. 111. Erythropoietic Effects of Normal Plasma," Ann. N. Y. Acad. Sci, 149, 516-527 (1968). Hanahan et al., "Plasmid screening at high colony density," Gene, 10, 63-67 (1980). Hauser et a]., "Inducibility of human /?-interferon in mouse L-cell clones," Nature, 297, 650-654 (Jun. 24, 1982). Hellmann et al., "Familial erythrocytosis with over-production of erythropoietin," Clin. Lab. Haemat., 5, 335-342 (1983). Hewick et al., "A Gas-Liquid Solid Phase Peptide and Protein Sequenators," J. Biol. Chem., 256, 7990-7997 (Aug. 1981). Hirs et al., "Peptides Obtained by Tryptic Hydrolysis of Performic Acid-Oxidized Ribonuclease," J. Biol. Chem. 219, 623-642 (1955). Hopp et al., "Prediction of protein antigenic determinants from amino acid sequences," P N.A.S. (USA), . 78(6), 3824-3838 D-7182 (Jun. 1981). Houghton et al., "The amino-terminal sequence of human fibroblast interferon as deduced from reverse transcripts obtained using synthetic oligonucleotide primers," Nucleic Acids Res. 8(9), 1913-1931 (1980). Huang et al., "Identification of Human Erythropoietin Receptor," Am. Saci of Biological Chemisrs, Am. Assoc. of Immunologisrs, Fed. Pract. (USA) 43(7) Abst. 2770, p. 1891 (1984). Huang et al., "Characterization of Human Erythropoietin cDNA clones," Am. Soc. of Biological Chemists, Am. Assoc. of Immunologists, Fed. Pract. (USA) 43(6) Abst. 1795, p. 1724 (DATE). Itakura, et a]., "Synthesis and Use of Synthetic Oligonucleotides," Ann. Rev. Biochem., 53, 323-356 (1984). Ito et al., "Solid phase synthesis of polynucloetides. VI. Further studies on polystryene copolymers for the solid support", Nucleic Acids Res. 10(5), 1755-1769 (1982). Jacobs et al., "Isolation and characterization of genomic and cDNA clones of human erythropoietin," Nature, 313, 806-809 (Feb. 28, 1985). Jacobsen et al., "Relative effectiveness of phenylhydrazine treatment and hemorrhage in the production of an erythropoietic factor," Blood, 11:937-945 (1956). Jacobsen et a]., "Role of the kidney in erythropoiesis," Nature, 179:633-634 (Mar. 23, 1957). Jaye et al., "Isolation of human anti-haemophilic factor IX cDNA clone using a unique 52-base synthetic oligo(List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 7 of 22
5,441,868
Paae 7 OTHER PUBLICATIONS nucleotide probe deduced form the amino acid sequence of bovine factor IX," Nucleic Acids Res. 11(8), 2325-2335 (1983). Jeffreys et al., "Sequence variation and evolution of hl nuclear DNA in man and the primates," P i . Trans. R. Soc. Lond., B 292 133-142 (1981). Jelkman et al., "Extraction of Erythropoietin from Isolated Renal Glomeruli of Hypoxic Rats," Exp. HematoL, 11(7), 581-588 (Aug. 1983). Kaiser et al., "Amphiphilic Secondary Structure: Design of Peptide Hormones," Science, 223, 249-255 (1984). Kajimura et al., "Cloning the Heavy Chain of Human HLA-DR Antigen Using Synthetic Oligodeoxyribonucleotides as Hybridization Probes," DNA. 2(3), 175-182 (1983). Kakidani et al., "Cloning and sequence analysis of cDNA for porcine 0-neoendorphin/dynorphin precursor," Nature, 298, 245-249 (Jul. 15, 1982). Kalmanti, "Correlation of clinical and in vitro erythropoietic responses to androgens in renal failure," Kidney rnt3r,22, 383-391 (1982). Karn et al., "Novel bacteriophage A cloning vector," P.N.A.S. (USA), 77, 5712-5176 (Sep. 1980). Katsuoka et al., "Erythropoietin Production in Human renal Carcinoma Cells Passaged in Nude Mice and in Tissue Culture," Gann, 74, 534-541 (Aug. 1983). Kaufman et al., "Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reductase Complementary DNA Gene," J. Mol. Biol. 159, 601-621 (1982). Kennel], "Principles and Practices of Nucleic Acid Hybridization," Prog. Nucl. Acid Res. Mot. Biol. 11, 259-301, p. 293 (1971). Kimura et al., "A frameshift addition causes silencing of the 8-globin gene in old world monkeys, an anubis," Nucleic Acids Res., 11(9):2541-2550 (1983). Knopf et al., "Cloning and Expression of Multiple Protein Kinase C cDNAs," Cell 46, 491-502 (Aug. 15, 1986). Kohne, "Evolution of Higher-organism DNA," Quarterly Reviews o Biophysics, 3~327-375(1970). f Konwalinka et al., "A Miniaturized Agar Culture System for Cloning Human Erythropoietic Progenitor Cells," Exp. Hematof., 12, 75-79 (1984). Korman, "cDNA clones for the heavy chain of HLA-DR antigens obtained after immunopurification of polysomes by monoclonal antibody," P.N.A.S. (USA), 79, 1844-1848 (Mar. 1982). Kornblihtt et a]., "Isolation and characterization of cDNA clones for human and bovine fibronectins," P.N.A.S. (USA), 80, 3218-3222 (Jun. 1983). Kramer et al., "Comparisons of the Complete Sequences of Two Collagen Genes from Caenorhabditis elegans," Cell 30, 599-606 (Sep. 1982). Krane, "The Role of Erythropoietin in the Anemia of Chronic Renal Failure," Henry Ford Hosp. Med. J., 31(3), 177-181 (1983). Krystal, "A Simple Microassay for Erythropoietin Based on 3H-Thymidine Incorporation into Spleen cells from Phenylhydrazine Treated Mice," Exp. Hematol., 1](I), 649-660 (Aug. 1983). Kurachi et al., "Isolation and characterization of a cDNA coding for human factor IX," P.N.A.S. (USA), 79, 6461-6464 (Nov. 1982). Kuratowska et al., "Studies on the production of erythropoietin by isolated perfused organs," Blood, 18:527-534 (1961). Kurtz, "A New candidate for the regulation of erythropoiesis: Insulin-like growth factor I," FEBS Letters, 149(1), 105-108 (Nov. 1982). Kyte et a]., "A Simple Method for Displaying the Hydropathic Character of a Protein," J. Mol. Biol., 157, 105-132 (1982). Lai et a]., "Ovalbumin is synthesized in mouse cells transformed with the natural chicken ovalbumin gene," P.N.A.S. (USA), 77(1), 244-248 (Jan. 1980). Lai et al., "Structural Characterization of Human Erythropoietin." J. o Biol. Chem., 261, 3116-3121 f (Mar. 5, 1986). Lai, "Technical improvements in Protein Microsequencing," Analytica Chimica Acra, 163, 243-248 (1984). Lange et al., "Application of erythropoietin antisera to studies of erythropoiesis," Ann. N.Z Acad. Sci, 149:281-291 (1968). Lappin et al., "The Effect of Erythropoietin and Other Factors on DNA synthesis by Mouse Spleen Cells," Exp. Hematol., 11(7), 661-666 (Aug. 1983). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 8 of 22
Page 8 OTHER PUBLICATIONS Lathe, "Synthetic Oligonucleotide Probes Deduced from Amino Acid Sequence Data," J. Mol. Biol. 183, 1-12 (1985). Laub and Ritter, "Expression of the Human Insulin Gene and cDNA in a Heterologous Mammalian System," J. Biol. Chem., 258(10), 6043-6050 (May 25, 1983). Lauffer et a]., "Topology of signal recognition particle receptor in endoplasmic reticulum membrane," Nature, 318, 334-338 (Nov. 28, 1985). Lawn et al., "The Isolation and Characterization of Linked 6- and &Globin Genes from a Cloned Library of Human DNA," Cell, 15, 1157-1 174 (Dec. 1978). Ledern et al., "Gmliosides: Structure. Isolation. and Analysis," Methods in Enzymology, 83 (Part D), 139-191 (1982). Lee-Huang, "The Erythropoietin Gene," Oncogenes, Genes and Growth Factors, Chap. 7, pp. 199-222, ed. Gordon Caraft, John Wiley & Sons, Inc. (1987). Lee-Huang, "Cloning of Human Erythropoietin," Biophysical J., 45(Part 2 of 2), ABT. M-PM-Al2, p. 30a (1984). Lee-Huang, "Monoclonal Antibodies to Human Erythropoietin," Abstract No. 1463, Fed. Proc., 41, 520 (1982). Lee-Huang, "A New Preparative Method for Isolation of Human Erythropoietin With Hydrophobic Interaction Chromatography," Blood, 56(4), 620-624 (Oct. 1980). Lee-Huang, "Cloning and Expression of Human EPO cDNA in E. coli," P.N.A.S. (USA), 81,2708-2712 (May 1984). Lerner et al., "Chemically synthesized peptides predicted from the nucleotide sequence of the hepatitis B virus genome elicit antibodies reactive with the native envelope protein of Dane particles," P.N.A.S. (USA), 78(6), 3403-3407 (Jun. 1981). Lerner, "Synthetic Vaccines," Scientifc American, 248(2) 66-74 (1983). Lerner et al., "Antibodies to Chemically Synthesized Peptides Predicted from D N A Sequences as Probes of Gene Expression," Cell, 23, 309-3 10 (Feb. 1981). Lewin Genes, 1983, John Wiley & Sons, p. 307. Lin et a]., "Cloning and expression of the human erythropoietin gene," P.N.A.S. (USA), 82, 7580-7584 (Nov. 1985). Lin et al., "Monkey erythropoietin gene: cloning, expression and comparison with the human erythropoietin gene," Gene. 44, 201-209 (1986). Lin et al., "Cloning of the Monkev EPO Gene." Abstract, J. Cell. ~ioch:, Suppl. 8B, p. 45 (Mar. 31-Apr. 24, 1984). Lin et al., "Cloning and Expression of Monkey and Human Erythropoietin," Exp. Hematol. 12, 357 (1984). Lipschitz et a]., "Effect of Age on Hematopoiesis in Man," Blood, 63(3), 502-509 (Mar. 1983). LKB Technical Bulletin #2217. Maniatis et al., "The Isolation of Structural Genes from Libraries of Eucaryotic DNA," Cell 15, 687-701 (Oct. 1978). Maniatis et a]., "Molecular Cloning, a Laboratory Manual", pp. 5, 197-199, 392-393, 479-487, 493-503 Cold Springs Harbor, N.Y. (1982). Martial et a]., "Human Growth Hormones: Complementary D N A Cloning and Expression in Bacteria," Science, 205, 602-606 (Aug. 10, 1979). Mason et al., "Complementary D N A sequences of ovarian follicular fluid inhibin show precursor structure and homology with transforming growth factor-p," Nature 318, 659-663 (Dec. 1985). Maurer, "Immunochemical Isolation of Prolactin Messenger RNA," J. Biol. Chem 255(1), 854-859 (Feb. 10, 1980). Maxam et a]., "Sequencing End-Labeled DNA with Base-Specific Chemical Cleavages," Methods in Enzymol. 65, 499-560 (1980). McGonigle et al., "Erythropoietin deficiency and inhibition of erythropoiesis in renal insufficiency," Kidney mt'r, 25(2),437-444 (1984). Mellon et a]., "Identification of DNA Sequences Required for transcription of the human al-Globin Gene in a New SV40 Host-Vector System," Cell, 27,279-288 @ec. 1981 ). Mellor et al., "Expression of Murine H-2Khu b 1 histocompatibility antigen in cells transferred with cloned H-2 genes," Nature, 298:529-534 (Aug. 1982). Messing, "New M13 Vectors for Cloning," Methods in Enzymology, 101, 20-78 (1983). Metcalf et al., "Effects of Purified Bacterially Synthesized Murine Multi-CSF (IL-3) on Hematopoiesis in Normal Adult Mice," Blood, 68(1), 46-57 (Jul. 1986). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 9 of 22
Page 9 OTHER PUBLICATIONS Metcalf et al., "Quantitative Responsiveness of Murine Hemopoietic Populations in vitro and in vivo to Recombinant Multi-CSF (IL-3)," Exp. HematoL, 15, 288-295 (1987). Methods in Yeast Genetics, Cold Spring Harbor Lab, Cold Spring Harbor, N.Y., p. 62 (1983) (not enclosed). Miller et a]., "Plasma levels of immunoreactive erythropoietin after acute blood loss in man," Brit. J. Haematol., 52, 545-549 (1982). Mirand, "Extra-renal and renal control of erythropoietin production," Ann. N. Y. Acad. Sci., 149:94-106 (1968). Mirand et al., "Current studies on the role of erythropoietin on erythropoiesis", Ann N. Y. Acad. Sci., 77:677-702 (1959). Miyake et al., "Purification of Human Erythropoietin," J. Biol. Chem., vol. 252(15), 5558-5564 (Aug. 1977). Mladenovic et al., "Anemia of Chronic Renal Failure (CRF) in the Sheep: Reponse to Erythropoietin (EP) In Vivo and In Vitro," Blood, 58(5), Suppl. 1, 99a (1981). Montgomery et al., "Identification and Isolation of the Yeast Cytochrome c Gene," Cell, 14, 673-680 (Jul. 1978). Moriarty et al., "Expression of the Hepatitis B Virus Surface Antigen Gene in Cell Culture by using a Simian Virus 40 vector," P. N. A.S. (USA), 78(4):2606- 10 (Apr. 1981). Moriuchi et al., "Thy-1 cDNa sequence suggests a novel regulatory mechanism," Nature. 301, 80-82 (Jan. 1983). Morrison, "Bioprocessing in Space-an Overview", The World Biotech Report, vol. 2:USA, 557-571 (1984). Munjaal et al., "A cloned calmodulin structural gene probe is complementary to D N A sequence from diverse species," P.N.A.S. (USA), 78(4):2330-2334 (Apr. 1981). Murphy et al., "The Role of Glycoprotein Hormones in the Regulation of Hematopoiesis," Acta. Haematologica Japonica, 46(7), 1380-1396 (Dec. 1983). Myers et al., "Construction and Analysis of Simian Virus 40 Origins Defective in Tumor Antigen Binding and D N A Replication," P.N.A.S. (USA), 77,6491-6495 (Nov. 1980). Myklebost et al., "The Isolation and Characterization of c D N A clones for Human Apolioprotein CII," J. of Biol. Chem.. 259(7), 4401-4404 (Apr. 10, 1984). Naets, "The role of the kidney in erythropoiesis," J. Clin. Invest., 39:102-110 (1960)Nagata et al., "Synthesis in E. coli of a polypeptide with human leukocyte interferon activity," Nature. 284, 316-320 (Mar. 27, 1980). Nakao et a]., "Erythropoiesis in anephric or kidney transplated patients," Israel J. Med. Sci, 7:986-989 (Jul.-Aug. 1971). Nathan et al., "Erythropoietin and the Regulation of Erythropoiesis," New Eng. J. Med., 308(9), 520-522 (Mar. 3, 1983). Naughton et al., "Evidence for an Erythropoietin-Stimulating Factor in Patients with Renal and Hepatic Disease," Acta. Haemat., 69, 171- 179 (1983). Naughton et al., "Evidence for a Hepatic-Renal Antagoinisrn in the Production of Hepatic Erythropoietin," Ann. Clin. Lab. Sci. 13(5), 432-438 (1983). Neeser et al., "A Quantitative Determination by Capillary Gas-Liquid Chromatography of Neutral and Amino Sugars (as 0-Methyloxime Acetates), and a Study on Hydrolytic Conditions for Glycoproteins and Polysaccharides In Order to Increase Sugar Recoveries," Anal. Blochem., 142, 58-67 (1984). Nigg et al., "Immunofluorescent localization of the transforming protein of Rous sarcoma virus with antibodies against a synthetic src peptide," P.N.A.S. (USA), 79, 322-5326 (Sep. 1982). Noda et al., "Primary structure of a-subunit precursor of Torpedo californica acetylcholine receptor deduced from cDNA sequence," Nature, 299, 793-797 (Oct. 28, 1982). Noda et al., "Cloning and sequence analysis of c D N A for bovine adrenal preproenkephalin," Nature, 295, 202-206 (Jan. 21, 1982). Noyes et al., "Detection and partial sequence analysis of gastrin mRNA by using an oligodeoxynucleotide probe," P.N.A.S. (USA), 76(4), 1770-1774 (Apr. 1979). Nussinov, "Eukaryotic Dinucleotide Preference Rules and their Implications for Degenerate Codon Usage," J. Mol. BioL, 149, 125-131 (1981). Ogle et al., "Production of erythropoietin in vitro: a review," In Vitm, 14(l I), 945-949 (1978). Ohkubo et al., "Cloning and sequence analysis of cDNA for rat angiotensinogen," P.N.A.S. (USA), 80, 2196-2200 (Apr. 1983). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 10 of 22
5,441,868
Page 10 OTHER PUBLICATIONS Ohno et al., "Inducer-responsive expression of the cloned human interferons pl gene introduced into cultured mouse cells," Nucleic Acids Res., 10(3), 967-976 (1982). Okayama et al., "High-Efficiency Cloning of Full-Length cDNA," Mol. & Cell. Biol., 2(2), 161-170 (Feb. 1982). Ovchinnikov et a]., "The Primary Structure of Escherichia coli RNA Polymerase," J. Biochem., 116, 62 1-629 (198 1). Palmiter et al. "Metallothionein-Human G H Fusion Genes Stimulate Growth of Mice," Science, 222, 809-814 (Nov. 18, 1983). Pankratz et al., "A Simple 3-Step Procedure for Purifying Baboon Urinary Erythropoietin to Apparent Homogeneity," Exp. Hematol., 11, Supp. 14, Abst. 102 (1983). Papayannopoulou et a]., "On the In Vivo Action of f Erythropoietin: A Quantitative Analysis," J. o Clin. Investigation, 51, 1179-1 185 (1972). Parekh et a]., "N-Glycosylation and in vitro Enzymatic Activity of Human Recombinant Tissue Plasminogen Activator Expressed in Chines Hamster Ovary Cells and a murine Cell Line," Biochemistry, 28, 7670-7679 (1989). Pavlovic-Kentera et al., "Effects of Prostaglandin Synthetase Inhibitors, Salt Overload and Renomedullary Dissection on the Hypoxia Stimulated Erythropoietin Production in Rats," Exp. Hematol, 8(Supp. 8), 283-291 (1980). Pellicer et al., "Altering Genotype and Phenotype by DNA-Mediated Gene Transfer," Science, 209, 1414-1422 (Sept. 19, 1980). Pennathur-Das et al., "Evidence for the Presence of CFU-E with Increased In Vitro Sensitivity to Erythropoietin in Sickle Cell Anemia," Blood, 63(5), 1168-71 (May 1984). Pennica et a]., "Cloning and expression of human tissue-type plasminogen activator cDNA in E-coli," Nature, 301,214-221 (Jan. 20, 1983). Pitha et al., "Induction of human &interferon synthesis with poly (rIarC) in mouse cells transfected with cloned c D N A plasmids," P.N.A.S. (USA), 79, 4337-4341 (Jul. 1982). "Points to Consider in the Characterization of Cell Lines Used to Produce Biologics," Jun. 1, 1984, Office of Biologics Research Review, Center for Drugs & Biologics, U.S. Food & Drug Administration (Section A, Part 2) (not enclosed). Powell et al., "Human erythropoietin gene: High level expression in stably transfected mammalian cells and chromosome localization," P. N. A.S. (USA), 83, 6465-6469 (Sep. 1986). Prooijen-Knegt, "In Situ Hybridization of DNA Sequences in Human Metaphase Chromosomes Visualized by an Indirect Fluorescent Immunocytochemical Procedure," Exp. Cell Res., 141, 398-407 (1982). Rambach et al., "Acid Hydrolysis of Erythropoietin," Proc. SOC. Exp. Biol., 99, 482-483 (1958). Ravetech et a]., "Evolutionary approach to the question of immunoglobulin heavy chain switching: Evidence from cloned human and mouse genes," P. N.A.S. (USA), 77(1 I), 6734-6738 (Nov. 1980). Recny et al., "Structural Characterization of Natural Human Urinary and Recombinant DNA-derived Erythropoietin," J. Biol. Chem., 262(35), 17156-17163 (Dec. 15, 1987). Reilly et al., "Use of synthetic oligonucleotides to clone genomic DNA: isolation of a tRNAhu Phe 1 gene from mouse," DNA, 1:I92 (1982). Resegotti et a]., "Treatment of aplastic anaemia with methenolone, s.tanozolol and nandrolone," Panminerva Medico, 23, 243-248 (1981). Reyes et a]., "Identification of an H-2Kb-Related Molecule by Molecular Cloning," Immunogenetics, 14, 383-392 (1981). Reyes et al., "Isolation of a cDNA clone for the murine transplantation antigen H-ZKb," P.N.A.S. (USA), 79, 3270-3274 (May 1982). Riggs et a]., "Synthetic DNA and Medicine," Am. J. Hum. Genet., 31, 531-538 (1979). Ringold et al., "Co-Expression and Amplification of Dihydrofolate Reductase cDNA and the Escherichia coli XGPRT Gene in Chinese Hamster Ovary Cells," J. Mol. & Appl. Genetics, 1(3), 165-175 (1981). Robson et a]., "Polysome immunoprecipitation of phenylalanine hydroxylase mRNA from rat liver and cloning of its cDNA," P.N. A.S. (USA), 79,470 1-4705 (Aug. 1982). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 11 of 22
5,441,868
Page 11 OTHER PUBLICATIONS Roh et al., "Plasma Disappearance of I1251abeled Human Uninary Erythropoietin in Rabbits," Fed. Proc., 29(2), 782 Abst. 3030 (1970). Ross et a]., "Phosphotyrosine-containing proteins isolated by affinity chromatography with antibodies to a synthetic hapten," Nature, 294,654-656 (Dec. 17, 1981). Rothmann et al., "Erythropoietin-Dependent Erythrocytosis Associated with Hepatic Angiosarcoma," J . SUQ. O O ~ C O ~ .105-108 (1982). 20, , Saito et al., "Translation of Human Erythropoietin-mRNAs," Exp. Hematol., 11 (14), 228 (1983). Saito et al., "In Vitro Assay of Erythropoietin: Simple Determination in a Small Amount of Human Serum Samples," Jap. J. Med., 23(1), 16-21 (Feb. 1984). Sanger et al., "DNA Sequencing with chain-terminating inhibitors," P.N.A.S. (USA), 74, 5463-5467 (Dec. 1977). Sasaki, "Carbohydrate Structure of Erythropoietin Expressed in Chinese Hamster Ovary Cells by a Human Erythropoietin cDNA," J. Biol. Chem., 262(25), 12059-12070 (Sep. 5, 1987). Sasaki, "Isolation of erythropoietin by monoclonal antibody," Biomed. Biochim. Acta., 42(11/12), S202-S206 (1983). Schulze et al., "Identification of the cloned gene for the murine transplantation antigen H-2Khu b l by hybridization with synthetic oligonucleotides," Mol. & Cell BioL, 3(4), 750-755 (Apr. 1983). Schwartz et al., "Severe Anemia as a Manifestation of Metastatic Jugular Paraganglioma," Arch Otolaryngol, 109, 269-272 (Apr. 1983). Seeburg et al., "Synthesis of growth hormone by bacteria," Nature, 276, 795-798 (Dec. 1978). Seki et a]., "Isolation of a genomic clone containing structural information for the D R a subunit", Fed. Proc., 41:365 (1982)/Chemistry and Molecular Biology of I a D r Antigens Abstract 563 (1982). Shahidi, "Androgens and Erythropoiesis," New Eng. J. Med.. 289, 72-80 (Jul. 12, 1973). Sherwood et al., "Erythropoietin Titers in Sickle Cell Disease & Chronic Renal Failure," Blood Suppl. 1, 58, Abstract 105 (198 1). Sherwood et a]., "Extraction of erythropoietin from normal kidneys," Endo, 103(3), 866-870 (1978). Sherwood et al., "A Radioimmunoassay for Erythropoietin," Blood, 54(4), 885-893 (Oct. 1979). Shiramizu et al., "Human Renal Carcinoma Cells Secreting Erythropoietin in vivo and in vitro," Blood, 78(10), Supp. 1 (Nov. 15, 1991). Singer-Sam et a]., "Isolation of a cDNA clone for human X-linked 3-phosphoglycerate kinase by use of a mixture of synthetic oligodeoxyribonucleotides as a detection probe," P.N.A.S. (USA), 80, 802-806 (Feb. 1983). Southern et al., "Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter," J. Mol. Appl. Genet., 1(4), 327-341 (1982). Southern, "Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis," J. Mol. Biol., 98, 503-517 (1975). Spellman et al., "Carbohydrate Structure of Recombinant Soluble Human CD4 Expressed in Chinese Hamster Ovary Cells," Biochemistry, 30(9), 2395-2406 (199 1). Spellman et al., "Carbohydrate Structure of Human Tissue Plasminogen Activator Expressed in Chinese Hamster Ovary Cells," J. of Biol. Chem., 264(24), 14100-141 11 (Aug. 26, 1989). Storring et al., "The International Standard for Recombinant DNA derived Erythropoietin: Collaborative Study of four recombinant DNA derived erythropoietins and two highly purified human urinary erythropoietins," J. of Endo., 134, 459-84 (1992). Strickland, "Occurrence of Sulfate on the N-Linked Oligosaccharides of Human Erythropoietin," J. of Celluiar Biochemistry, Suppl. 16D, Abstract No. P324 (1992). Sue et al., "Site-specific antibodies to human erythropoietin directed toward the NH2-terminal region," Proc. Nut. Acad. Sci. (USA), 80, 3651-3655 (1983). Suggs et a]., "Use of Synthetic Oligodeoxyribonucleotide for the Isolation of Specific Cloned DNA Sequences," Developmental Biology Using Purified Genes, 683-693 (D. Brown, Ed., 1981). Sytowski et al., "The Biochemistry of Erythropoietin: An Approach to its mode of Action," Exp. Hematol, 8(Supp. 8), 52-63 (1980). (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 12 of 22
5,441,868
Page 12 OTHER PUBLICATIONS Sytowski et al., "A Novel Radioimmunoassay for Human Erythropoietin Using a Synthetic NHz-Terminal Polypeptide and Anti-Peptide Antibodies," J. Immunol. Methods, 69, 181- 186 (1984). Szostak et al., "Hybridization with Synthetic Oligonucleotides," Meth. in Enzymol., 68, 419-429 (1979). Takeuchi et al., "Relationship between sugar chain structure and biological activity of recombinant human erythropoietin produced in Chinese hamster ovary cells," P.N.A.S. (USA), 86, 7819-7822 (Oct. 1989). Takeuchi, "Comparative Study of the Asparagine-linked Sugar Chains of Human Erythropoietin Purified from Urine and the Culture Medium of Recombinant Chinese Hamster ovary Cells," J. BioL Chem., 263(8), 3657-3663 (Mar. 15, 1988). Talmadge et al., "Eukaryotic Signal Sequence Transports Insulin Antigen in Escherichia coli," P.N.A.S. USA 77(6), 3369-3373 (Jun. 1980). Tambourin et al., "Production of erythropoietin-like' activity by a murine erythroleukemia cell line," P.N.A.S. (USA), 80, 6269-6273 (1983). Taub et al., "An improved method for preparing large arrays of bacterial colonies containing plasmids for hybridization: in situ purification and stable binding of D N A on paper filters," Chemical Abstracts, 97(23), 164, Abstract No. 194002~ (Dec. 12, 1982). Taub et al., "An Improved Method for Preparing Large Arrays of Bacterial Colonies Containing Plasmids for Hybridization: In Situ Purification and Stable Binding of D N A on Paper Filters," Anal. Biochem., 126, 222-230 (1982). Testa et al., "Role of Purified Erythropoietin in the Amplification of the Erythroid Compartment," Exp. Hematol., 8(Supp. 8), 144-152 (1980). Tong et a]., "The Formation of Erythrocyte Membrane Proteins during Erythropoietin-induced Differentiation," J. Biol. Chem., 256(24), 12666-12672 (Dec. 25, 1981). Toole et al., "Molecular cloning of a cDNA encoding human antihaemophilic factor," Nature, 312, 342-347 (Nov. 8, 1984). Tramontano et al., "Statistical evaluation of the coding capacity of complementary DNA strands," Nucleic Acids Research, 12(12), 5049-5059 (1984). Udupa et a]., "Erythropoiesis in the aged mouse," J. ~ a b Clin. Med., 103(4),-574-580 & 58 1-588 (1984). : Ullrich et a]., "Rat Insulin Genes: Construction of Plasmids Containing the Coding Sequences," Science, 196, 1313-1319 (Jun. 17, 1977). Ullrich et al., "Isolation of the Human Insulin-like Growth Factor I Gene Using a Single Synthetic DNA Probe," EMBO J., 3(2):361-364 (1984). Ullrich et al., "Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells," Nature, 309, 418-425 (May 31, 1984). Ullrich et at., "Insulin-like growth factor I receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity," EMBO J., 5(10), 2503-25 12 (1986). Ullrich et al., "Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes," Nature, 313, 756-761 (Feb. 28, 1985). Urabe et at., "The Influence of Steroid Hormone Metabolites on the In Vitro Development of Erythroid Colonies Derived from Human Bone Marrow," J. Exp. Med., 149, 1314-1325 (Jun. 1979). Urlaub et at., "Isolation of Chinese Hamster cell mutants deficient in dihydrofolate reductase activity," Proc. Nat. Acad. Sci. (USA), vol. 77(7), 4216-4220 (Jul. 1980). Van der ploegkt at., "DNA Methylation in the Human vSp-Globin Locus in Erythroid and Nonerythroid Tissues," Cell, 19, 947-958 (Apr. 1980). Van Stone et al., "Effect of erythropoietin on anemia of peritoneall y dialyzed anephric rats," Kidney Int'l., 15, 370-375 (1979). Vedovato et at., "Erythropoietin Levels in Heterozygous Beta-Thalassemia," Acta. Haematol., 7 1,211-2 13 (1984). Vichinsky et al., "Inadequate erythroid response to hypoxia in cystic fibrosis," J. Pediatr., 105(1), 15-21 (Jul. 1984). Vieira et al., ''The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers," Gene, 19, 259-268 (1982). Villasante et al., "Binding of microtubule protein to (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 13 of 22
Page 13 OTHER PUBLICATIONS D N A and chromatin: possibility of simultaneous linkage of microtubule to nucleic acid and assembly of the microtubule structure," Nucleic Acids Res, 9(4), 895 (1981). Walker et al., Techniques in Molecular Biology, MacmilIan Pub. Co., N.Y., p. 280 (1983). Wallace et al., "Hybridization of synthetic oligodeoxyribonucleotides to Phi-chi 174 DNA: the effect of single base pair mismatch," Nuc. Acids Res., 6(1 I), 3543-3557 (1979). Wallace et a]., "Directed Deletion of a Yeast Transfer RNA Intervening Sequence," Science, 209:1396-1400 (Sep. 19, 1980). Wallace et al., "Oligonucleotide Directed Mutagenesis of the Human P-globin gene: A General Method for Producing Specific Point Mutations in cloned DNA," Nucleic Acids Research, 9(15):3647-3657 (1981). Wallace et al., "The use of synthetic oligonucleotides as hybridization probes. 11. Hybridization of oligonucleotides of mixed sequence to rabbit P-globin DNA," Nuc. Acids Rex, 9(4), 879-894 (1981). Wallace et al., "A set of synthetic oligodeoxyribonucleotide primers for DNA sequencing in the plasmid vector pBR322," Gene, 16, 21-26 (1981). Wallis et al., "The isolation of cDNA clones for human apolipoprotein E and the detection of apoE RNA in hepatic and extra-hepatic tissues," EMBO J., 2, 2369-2373 (1983). Walter et al., "Antibodies specific for the carboxy- and amino-terminal regions of simian virus 40 large tumor antigen," P.N.A.S. (USA), 77(9), 5 197-5200 (Sep. 1980). Walter et al., "Antibodies specific for the polyoma virus middle-size tumor antigen," P.N.A.S. (USA), 78, 4882-4886 (Aug. 1981). Wang et al., "Some Chemical Properties of Human Erythropoietin", Endo, 116(6), 2286-2292 (1985). Wang et a]., "Renal and extrarenal erythropoietin production in male and female rats of various ages," J. Lab. Clin. Med., 79(2), 181-186 (Feb. 1972). Weiland et al., "In vivo Activity of Asialo-Erythropoietin in Combination with Asialo-Glycoproteins," Blut, 44(3), 173-175 (1982). Weiss et al., "Characterization of a monoclonal antibody to human erythropoietin," P.N.A.S. (USA), 79, 5465-5469 (1982). Weiss et al., "Studies of the pathogenesis of anemia of inflammation: Mechanism of impaired erythropoiesis," Am. J. Vet. Res., 44(10), 1832-1835 (Oct. 1983). White et al., "Studies on Erythropoietin," Recent Progr. Hormone Res., 16:219-262 (1960). Whitehead et al., "Use of a cDNa Clone for the Fourth Component of Human Complement (C4) for Analysis of a Genetic Deficiency of C4 in Guinea Pig", PNAS (USA), 805387-5391 (Sep. 1983). Wiaderkiewicz et al., "Mismatch and blunt to protruding-end joining by DNA ligases," Nucleic Acids Res, 15(19), 7831-7848 (1987). Wide et al., "Molecular charge heterogeneity of human serum erythropoietin," British J. Huemat., 76, 121-127 (1990). Wong et al., "Synthetic peptide fragment of src gene product inhibits the src protein kinase and crossreacts immunologically with avian onc kinases and cellular phosphoproteins," P.N.A.S. (USA), 78(12), 7412-7416 (Dec. 1981). Woo, "A Sensitive and Rapid Method for Recombinant Phage Screening," Methods in Enzymology, 68, 389-395 (1979). Wood et al., "Expression of active human factor VIII from recombinant DNA clones," Nature, 312, 330-336 (Nov. 22, 1984). Woods et al., "Isolation of a cDNA Clone Corresponding to the MfIC Linked Complement Protein Factor 3,"Mol. Immunology, 19, 1411 (1982). Woods et al., "Isolation of cDNA clones for the human complement protein factor B, a class I11 major histocompatability complex gene product," P.N.A.S. USA 79, 5661-5665 (Sept. 1982). Woods et al., "Isolation of Class I11 c D N A Clones," Second Meeting on Cloning o the HLA and H-2 Regions, f Abstract (Apr. 17-19, 1983). Yanagawa et al., "Hybridomas for Production of Monoclonal antibodies to Human Erythropoetin," Blood, 64(2), 357-364 (Aug. 1984). Yanagawa et al., "Isolation of Human Erythropoietin with Monoclonal Antibodies," J. Biol. Chem, 259(5), 2707-2710 (Mar. 10, 1984). Young et al., "Efficient isolation of genes by using antibody probes," P.N.A.S. 80, 1194-1 198 (Mar. 1983). (List contiliued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 14 of 22
Page 14 OTHER PUBLICATIONS Yuen et a]., "The Spectrum of N-linked oligosaccharide structures detected by enzymic microsequencing on a recombinant soluble CD4 glycoprotein from Chinese hamster ovary cells," Eur. J. Biochem., 192,523-528 (1990). Zinn et al., "Regulated expression of an extrachromosoma1 human &interferon gene in mouse cells," P. N.A.S. (USA), 79, 4897-4901 (Aug. 1982). Bos et al., pp. 125- 130, in Proc.Symp.Mol.BioL Negat., Strand Vircrses Meeting, 1983, Compans, et al., eds. Acad. Press (1984). Colby et al., J.lmmunol., 133(6), 3091-3095 (1984). Davis et al., Proc.Natl.Acad.Sci.(USA), 80, 3976-3980 (1983). Devos et al., Linterferon Research, 4, 461-468 (1984). Fan et a)., Proc.Nat1.Acad. Sci.(USA), 80, 5965-5969 (1983). Fiers et al., Phil. TransR.Soc.Lond., B299, 29-38 (1982). Fischinger et al., Proc.NatLAcad.Sci. (USA), 78, 1920-1924 (198 1). Garoff et al., J. CelLBiol., 97, 652-658 (1983). Gething et al., pp. 263-268 in Modern Approaches To Vaccines, Chanock et al., eds. Cold Spring Harbor Lab (1984). Gough et al., Nature, 309, 763-767 (1984). 79, Hartman et al., Proc.NatLAcad.Sci.(USA), 233-237 (1982). Haynes et al., Nucleic Acids Res., 11(3), 587-706 (1983). Haynes et al., pp. 111-129 in Humoral Factors in Host Defense, Yamamura et a]., eds. Acad. Press (1983). Kenter et al., J.Cell Biol., 98, 2215-2221 (1984). Kieny et al., Nature, 3 12, 163-166 (1984). Kondor-Koch et al., J.Cell.Biol., 97, 644-651 (1983). Konrad, Ann.N. Y.Acad.Sci., 413, 12-22 (1983). Kuhn et al., Cell, 37, 95-103 (1984). Lasky et al., pp. 189-194 in Modern Approaches To Vaccines, Chanock et a]., eds. Cold Spring Harbor Lab. (1984). Laub et al., J. ViroL, 48(1), 271-280 (1983). Markoff et al., Mol. & Cell. Biol., q l ) , 8-16 (1984). McCormick et al., Mol. & Cell. Biol., 4(1), 166-172 (1984). Meier et al., Biochem. & Biophys.Res.Comm., 118(1), 73-81 (1984). Nayak et al., pp. 165-172 in Modern Approaches TO Vaccines, Chanock et al., eds. Cold Spring Harbor Lab. (1984). Newman et al., Nature, 304, 643-645 (1983). Paabo et al., Cell. 35, 445-453 (1983). Pennica et al., Nature, 312, 724-729 (1984). Ramabhadran et a],. Proc.NatL Acad.Sci (USA), 81, 6701-6705 (1984). Rose et al., Cell, 30, 753-762 (1982). Roth et al., Cell, 33, 435-443 (1983). Sambrook et al., pp. 225-246 in Experimental Manipulation of Gene Expression, Acad. Press. (1983). Scahill et al., Proc.NatI.Acad.Sci.(USA), 4654-4658 80, (1983). Smith et al., Proc.NatLAcad.Sci.(USA), 80, 7155-7159 (1983). Srinivas et al., J.Biol.Chem., 258, 14718-14724 (1983). Steck et al. Transplantation Proceedings, 16, 355-360 (1984). Weissmann et al., Phil.Trans.R.Soc.Lond., B299, 7-28 (1982). White et al., Nature, 300, 658-659 (1982). Wiktor et al., Proc.Natl.Acad.Sci.(USA), 81, 7194-7198 (1984). Gething et al., "Cell-surface expression of influenza haemagglutinin from a cloned DNA copy of the RNA gene", Nature, 293:620-625 (22 Oct. 1981). Higashi et al., "'Structure and Expression of a Cloned cDNA for Mouse Intefferon-P*," J. Biol. Chern, 258(15):9522-9529 (1983). Kaufman et al., "Expression and Amplification of DNA Introduced into Mammalian Cells," Gene Amplification. R. T . Schimke ed., Cold Spring Harbor, N.Y., 245-250 (1982). Marshall, "Glycoproteins," Annual Review of Biochemistry, Snell et al. eds., vol. 41, pp. 673-702, Annual Reviews Inc., Palo Alto, Calif. (1972). McCormick et a]., "Regulated Expression of Human Intefferon Genes In Chinese Hamster Ovary Cells," DNA, 2(1): 86 Abst 86 (1983). Rigby, "Expression of cloned genes in eukaryotic cells using vector systems derived from vital replicons," Genetic Engineering, R. Willisamson, ed., 3:83-140, Academic Press, London 1982. (List continued on next page.)
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 15 of 22
Page 15 OTHER PUBLICATIONS Stanley, "Surface Carbohydrate Alterations of Mutant Mammalian Cells Selected for Resistance to Plant Lectins," The Biochemistry of Glycoproteins and Proteoglycans, Chapter 4:161- 189, Lennarz ed., Plenum Press (1980). Sveda et a]., "Functional expression in primate cells of cloned DNA coding for the hemagglutinin surface glycoprotein of influenza virus," Proc. Nat'l. Acad. S i c. (USA), 78(10):5488-5492 (Sep. 1981).
-
-
Taniguchi et al., "Structure and expression of a cloned cDNA for human intefieukin-2," Nature, 302:305-3 10 (24 Mar. 1983). Wickens et al., "Expression of a chicken chromosomal ovalbumin gene injected into frog oocyte nuclei," Nature, 285:628-634 (26 Jun. 1980). Wong et al., "Intefferon-y Induces Enhanced Expression of Ia And H-2 Antigens on B Lymphoid, Macrophage, and Myeloid Cell Lines," J. Immun., 131(2):788-793 (Aug. 1983).
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 16 of 22
U.S. Patent
Aug. 15, 1995
Sheet 1 of 27
O/o
INHIBITION
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 17 of 22
U.S. Patent
Aug. 15, 1995
Sheet 2 of 27
A signal
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 18 of 22
U.S. Patent
A U ~ 15, .
1995
Sheet 3 of 27
5,441,868
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 19 of 22
U.S. Patent
Aug. 15, 1995
Sheet 4 of 27
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 20 of 22
FIG. 5A
Sau3A GATCCCGCGCCCCCTGGACAGCCGCCCTCTCCTCCAGGCCCGTGGGGCTGGCCCTGCCC
CGCTOMCTTCCCGGGATGAGGACTCCCGGTGTGGTCACCGCGCGCCTAGGTCGCTGAG
-2 7 -2 0
Met Oly Val His Glu Cys Pro Ala Trp GGACCCCGGCCAGGCGCGGAGATG GQG GTG CAC O M TGT CCT GCC TGG
-10
Leu Trp Leu Leu Leu Her Leu Val Ser Leu Pro Leu Gly Leu Pro CTG TOG CTT CTC CTG TCT CTC GTG TCG CTC CCT CTG GGC CTC CCA
-1 +1 10 Val Pro Gly Ala Pro Pro Arg Leu Ile Cys Asp Ger Arg Val Leu aTc CCG G ~ GCC CCA CCA cac CTC ATC TOT GAC AGC CGA GTC CTG C
20
*
e
40
Glu Arg Tyr Leu Leu Qlu Ala Lys Glu Ala Glu Asn Val Thr Met GAG AGG TAC CTC TTG GAG acc AAO GAG GCC GAG AAT GTC ACG ATG
30
Gly Cys 8er Glu Ser Cys Ser Leu Aan Glu Asn Ile Thr Val Pro aoc TGT TCC a m AOC TGC AGC TTG AAT GAG AAT ATC ACC GTC CCA
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 21 of 22
50
A s p T h r L y s V a l A a n P h e T y r A l a T r p L y s Arg Met G l u Val G l y GAC ACC AAA GTT AAC TTC TAT GCC TGG AAG AGG ATG GAG GTC GGG
60
70
G l n G l n A l a V a l 81u V a l T r p G l n G l y ~ e A l a L e u L e u Ser ~ l u u CAG CAG GCT GTA 6AA GTC TOG CAO GGC CTO GCC CTG CTC TCA GAA
80 a A l a V a l L e u Arg O l y G l n A l a V a l L e u A l a A s n Ser f l e r O l n Pro GCT GTC CTG CGG GGC CAG GCC GTO TTG GCC AAC TCT TCC CAQ CCT 90 100
Phe G l u Pro Leu O l n L e u H i s M e t A s p t y s A l a f i e Ser Q l y L e u
TTC GAG CCC CTG CAG CTG CAC ATG GAT AAA GCC ATC AGT GGC CTT
110
Arg Ser Ile T h r T h r L e u L e u Arg A l a L e u Q l y A l a Q l n G l u A l a
cac
AGC ATC ACC ACT CTQ CTT COG OCG CTO C~QA GCC CAQ GAA QCC
120
130
I l e 8er L e u Pro A s p A l a A l a f l e r A l a A l a P r o L e u Arg T h r Ile
ATC TCC CTC CCA GAT GCO GCC TCG GCT QCT CCA CTC CGA ACC ATC
140
T h r A l a A s p T h r P h e C y s L y s L e u Phe Arg Val T y r 8er A s n Phe ACT QCT GAC ACT TTC TGC AAA CTC TTC CGA GTC TAC TCC AAT TTC
Case 1:05-cv-12237-WGY
Document 810-3
Filed 08/13/2007
Page 22 of 22
FIG. 5C
150 160 Leu Arg Gly Xlys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Arg CTC CGG GGA M G CTG AAG CTG TAC ACG GGG GAG GCC TGC AGG AGA
165
Gly Asp Arg OP GGG GAC AGA TGA CCAGGTGCGTCCAGCTGGGCACATCCACCACCTCCCTCACCAACA
CTGCCTGTGCCACACCCTCCCTCACCACTCCCGAACCCCATCGAGGGGCTCTCAGCTMG
CGCCAGCCTGTCCCATGGACACTCCAGTGCCAGCMTGACATCTCAGGGGCCAGAGOAAC
AGGMGCATTCAGAGAGCAGCTTTAAACTCAGGAGCAOAGACAATGCAOGGAAAACACCT
GAGCTCACTCGGCCACCTGCAAAATTTGATGCAGGACACQCTTTOGAGGCAATTTACCTG
TTTTTGCACCTACCATCAGGGACAGGATOACTGGAGMCTTAGGTGGCMGCTGTGACTT
CTCMGGCCTCACGGGCACTCCCTTGGTGGCMGAGCCCCCTTGACACTGAGAGMTATT
TTGCMTCTGCAGCAGGAAAAATTACGGACAGGTTTTGGAGGTTGGAGGGTACTTGACAG
Disclaimer: Justia Dockets & Filings provides public litigation records from the federal appellate and district courts. These filings and docket sheets should not be considered findings of fact or liability, nor do they necessarily reflect the view of Justia.
Why Is My Information Online?