Association For Molecular Pathology et al v. United States Patent and Trademark Office et al

Filing 184

DECLARATION of Jennifer C. Tempesta in Support re: 181 MOTION to File Amicus Brief.. Document filed by Biotechnology Industry Organization. (Attachments: # 1 Exhibit 1, # 2 Exhibits 2-8, # 3 Exhibits 9-12, # 4 Exhibits 13-16, # 5 Exhibits 17-21, # 6 Exhibits 22-24, # 7 Exhibit 25, # 8 Exhibits 26-28)(Tempesta, Jennifer)

Association For Molecular Pathology et al v. United States Patent and Trademark Office et al

Doc. 184 Att. 2

EXHIBIT 2

Dockets.Justia.com

EXHIBIT 3

)LJXUH 7 KH RUJDQL]DWLRQ RI JHQHV RQ D KXPDQ FKURPRVRPH $ &KURPRVRPH RQH RI WKH VPDOOHVW KXPDQ FKURPRVRPHV FRQWDLQV î QXFOHRWLGH F SDLUV DQG PDNHV XS DSSUR[LPDWHO\ RI WKH HQWLUH KXPDQ JHQRPH 0RVW RI WKH OHIW DUP RI SKURPRVRPH FRQVLVWV RI VKRUW UHSHDWHG VHTXHQFHV RI '1$ WKDW DUH SDFNDJHG LQ D F DUWLFXODUO\ FRPSDFW IRUP RI FKURPDWLQ KHWHURFKURPDWLQ ZKLFK LV GLVFXVVHG ODWHU LQ WKLV KDSWHU % $ WHQIROG H[SDQVLRQ RI D SRUWLRQ RI FKURPRVRPH ZLWK DERXW JHQHV LQGLFDWHG 7KRVH LQ GDUN EURZQ DUH NQRZQ JHQHV DQG WKRVH LQ OLJKW EURZQ DUH SUHGLFWHG JHQHV & $Q H[SDQGHG SRUWLRQ RI % VKRZV WKH HQWLUH OHQJWK RI VHYHUDO JHQHV ' 7KH LQWURQ H[RQ DUUDQJHPHQW RI D W\SLFDO JHQH LV VKRZQ DIWHU D IXUWKHU WHQIROG H[SDQVLRQ (DFK H[RQ UHG F XRGHV IRU D SRUWLRQ RI WKH SURWHLQ ZKLOH WKH '1$ VHTXHQFH RI WKH LQWURQV JUD\ LV UHODWLYHO\ î QXFOHRWLGH SDLUV LV GLVWULEXWHG RYHU DQLPSRUWDQW 7KH HQWLUH KXPDQ JHQRPH V XWRVRPHV DQG VH[ FKURPRVRPHV VHH )LJXUHV DQG 7KH WHUP KXPDQ JHQRPH HTXHQFH UHIHUV WR WKH FRPSOHWH QXFOHRWLGH VHTXHQFH RI '1$ LQ WKHVH FKURPRVRPHV %HLQJ GLSORLG D KXPDQ VRPDWLF FHOO WKHUHIRUH FRQWDLQV URXJKO\ WZLFH WKLV DPRXQW RI '1$ +XPDQV R GLIIHU IURP RQH DQRWKHU E\ DQ DYHUDJH RI RQH QXFOHRWLGH LQ HYHU\ WKRXVDQG DQG D ZLGH YDULHW\ V I KXPDQV FRQWULEXWHG '1$ IRU WKH JHQRPH VHTXHQFLQJ SURMHFW 7KH SXEOLVKHG KXPDQ JHQRPH HTXHQFH LV WKHUHIRUH D FRPSRVLWH RI PDQ\ LQGLYLGXDO VHTXHQFHV $GDSWHG IURP ,QWHUQDWLRQDO +XPDQ *HQRPH 6HTXHQFLQJ &RQVRUWLXP 1DWXUH ±

&RS\ULJKW

%UXFH $OEHUWV 'HQQLV %UD\ -XOLDQ /HZ LV 0DUWLQ 5DII .HLWK 5REHUWV DQG -DPHV ' :DWVRQ

EXHIBIT 4

)LJXUH 7 0KH VWUXFWXUH RI HXNDU\RWLF JHQHV Q RVW HXNDU\RWLF JHQHV FRQWDLQ VHJPHQWV RI FRGLQJ VHTXHQFHV H[RQV LQWHUUXSWHG E\ SRQFRGLQJ VHTXHQFHV LQWURQV %RWK H[RQV DQG LQWURQV DUH WUDQVFULEHG WR \LHOG D ORQJ ULPDU\ 51$ WUDQVFULSW 7KH LQWURQV DUH WKHQ UHPRYHG E\ VSOLFLQJ WR IRUP WKH PDWXUH P51$

&RS\ULJKW

*HRIIUH\ 0 &RRSHU

EXHIBIT 5

)

LJXUH $ $ OWHUQDWLYH 6SOLFLQJ 3DWWHUQV D SUH P51$ ZLWK PXOWLSOH H[RQV LV VRPHWLPHV VSOLFHG LQ GLIIHUHQW ZD\V +HUH ZLWK WZR HOWHUQDWLYH H[RQV H[RQV $ DQG % SUHVHQW WKH P51$ FDQ EH SURGXFHG ZLWK QHLWKHU LWKHU RU ERWK H[RQV LQFOXGHG 0RUH FRPSOH[ DOWHUQDWLYH VSOLFLQJ SDWWHUQV DOVR DUH SRVVLEOH

&RS\ULJKW

: + )UHHPDQ DQG &RPSDQ\

EXHIBIT 6

nc.ude.uhw@cctcc ro moc.anis@jzcmaixil :liam-E 33845786-72-68 :xaF ;10045786-72-68 :leT .desserdda eb dluohs ecnednopserroc mohw oT*

1ACRB epyt-dliw eht gninolc fo esruoc eht ni deziretcarahc dna detceted yllatnedicni era eneg 1ACRB fo sANDc gnicilps evitanretlA .)3002 ,.la te ,gniK ;4991 ,.la te ,ikiM( ecneuqes gnidoc eritne eht tuohguorht dnuof neeb evah snoitatum fo srebmun ,eneg 1ACRB fo gninolc eht ecniS .ytilibitpecsus recnac nairavo dna tsaerb htiw seilimaf fo %09 ot pu dna recnac tsaerb detirehni htiw stneitap fo %05 yletamixorppa ni dnuof era snoitatum 1ACRB .)4991 ,.la te ,ikiM( sdica onima 3681 fo nietorp a gnidocne ,snoxe gnidoc 22 fo desopmoc si eneg 1ACRB .noitcnuf sti gnidnatsrednu fo mia eht htiw nekatrednu neeb evah seiduts suoremun ,etad taht morf dna ,4991 ni denolc saw eneg 1ACRB .)3002 ,.la te ,gniK ;6991 ,.la te ,naigitvaT ;5991 ,.la te ,retsooW ;4991 ,.la te ,ikiM( seneg rojam owt eht era 2ACRB dna 1ACRB ,eseht gnomA .deifitnedi dna denolc neeb evah recnac tsaerb htiw detaicossa seneg fo rebmun a ,edaced tsap eht gniruD .dlrow nretsew eht ni nemow gnitceffa recnac nommoc tsom eht si recnac tsaerB .)5002 ,.la te ,aninlaK( noitnevretni cituepareht rof stegrat sa elbatius snegitna romut dna srekramoib citsongorp ro citsongaid fo yrevocsid eht rof ecruos levon a sedivorp smrof ecilps cificeps-recnac fo noitacifitnedi eht ,suhT .tnempoleved romut gnitomorp snietorp fo noitcnuf fo niag yb ro srosserppus romut gnitavitcani yb rehtie ,sisenegiromut ni elor tnacifingis yllanoitcnuf a yalp ot nwohs neeb evah gnicilps ni segnahc ,sesac emos ni tsael tA .)4002 ,.la te ,ocnalB-aicraG ;3002 ,kcalB( ypareht dna esaesid ot tnaveler ylhgih osla si gnicilps evitanretlA .emoneg fo ytixelpmoc lanoitcnuf fo stnenopmoc tnacifingis tsom eht fo eno si hcihw ,ecneuqes gnidoc elgnis a morf decudorp eb ot snoitcnuf tnereffid htiw stcudorp eneg ynam swolla ANRm fo gnicilps evitanretlA .)3002 ,repooC dna onitsuaF ;1002 ,yelevarG( snietorp fo noitacifisrevid lanoitcnuf dna noisserpxe eneg etaluger ot setoyrakue rehgih ni desu ssecorp daerpsediw a si gnicilps evitanretlA .)5002 ,.la te ,aninlaK( smrof ecilps evitanretla evah yam seneg namuh fo %07 ot pu taht etacidni )SA( gnicilps evitanretla fo sesylana ediwemoneg tneceR
noitcudortnI

sisenegiromuT ,1ACRB ,recnac tsaerB ,gnicilps evitanretlA :sdrowyeK

.noitnevretni cituepareht rof stegrat sa elbatius snegitna romut dna srekramoib citsongorp ro citsongaid fo yrevocsid eht rof ecruos levon a edivorp lliw smrof ecilps cificeps-recnac fo noitacifitnedi eht ,suhT .recnac nairavo ro/dna tsaerb fo sisenegiromut eht ni elor rojam a syalp ylbissop 1ACRB fo gnicilps evitanretla taht dezisehtopyh eW .stnairav ecilps fo rebmun egral a yldetcepxenu evah yam 1ACRB eneg detaicossa recnac tsaerb taht detseggus stluser esehT .sisylana RCP-TR yb selpmas sutef namuh dna takruJ ,9H ,CIH ,ALH ,aleH ,265K ,S534-BM-ADM ni eneg 1ACRB fo stpircsnart wen eseht fo ecneserp eht demrifnoc ew ,noitidda nI .level nietorp eht ta enil llec 03-57-RZ ni desserpxe erew stnairav ecilps 1ACRB emos taht detacidni sisylana tolb nretseW .emarf gnidaer lanigiro eht tpek llits stnairav ecilps 1ACRB eseht tsoM .elur GA-TG htiw dedrocca smrof ecilps esehT .01 dna 9 snoxe saw rehto eht dna ,3 dna 2 snoxe saw eno :strap owt no desucof erew gnicilps evitanretla fo snoitacol eht dna b11 noxe gniteled smrof ecilps eseht llA .gnicilps evitanretla '3 dna '5 fo msinahcem ralucelom eht morf decudorp erew smrofosi ecilps esehT .levon erew hcihw fo smrof ecilps evif ,eneg 1ACRB epyt-dliw htiw derapmoc ,deziretcarahc dna detalosi erew smrof ecilps 1ACRB enin taht dewohs sisylana ecneuqeS .dohtem RCP-TR yb 03-57 -RZ enil llec recnac tsaerb morf denolc erew 1ACRB eneg detaicossa recnac tsaerb fo snoxe 31-1 drawrof eht ,yduts siht nI .seilimaf niatrec ni seicnangilam eseht ot ytilibitpecsus desaercni ecudorp eneg 1ACRB eht ni snoitatum dna ,nemow gnoma ycnangilam nommoc tsom eht si recnac tsaerB

6002 tsuguA 41 detpeccA ,6002 yluJ 01 devieceR
anihC .R . ,270034 ,ytisrevinU nahuW ,secneicS efiL fo egelloC ,ygoloriV fo yrotarobaL yeK etatS P anihC .R . ,270034 ,ytisrevinU nahuW ,noitcelloC erutluC epyT rof retneC anihC P
2,1 2,1 2 2,1

2

1

* iygnoC gnehZ dna gnaijoahC uG , oahC nehS , naijihZ oaC , aixiL oaiM
,2,1

eniL lleC recnaC tsaerB morf 1ACRB eneG detaicossA recnaC tsaerB fo gnicilpS evitanretlA

12-51 .pp ,7002 yraunaJ ,1 .oN ,04 .loV ,

ygoloiB raluceloM dna yrtsimehcoiB fo lanruoJ

3044 ,31 noxe 83 ,a1 noxe noitacoL

pb 42 pb 02 htgneL

GTACCCTCGGTCGGAAGATTGTCG GGGTCAATAGACTCTTTGGG )'3-'5( ecneuqes remirP

PR PF eman sremirP

1ACRB eneg detaicossa recnac tsaerb fo 31-1 snoxe etalosi ot RCP-TR rof sremirP .1 elbaT

saw dna raga %2.1 no deserohportcele saw ANR ,ANR latot fo ytilauq eht tceted ot redro nI .noitcurtsni s'erutcafunam eht ot gnidrocca )negortivnI( tnegaer LOZIRT gnisu deraperp erew selpmas eussit ro senil llec fo ANR latoT .RCP-TR dna noitcartxe ANR .dessecorp litnu Co08- ta derots dna ,negortin diuqil ni nezorf ylkciuq ,seceip 3mm 1 otni tuc dna detarapes erew sromut dna sutef eht morf seussit elpitluM .snoitaler eht dna eettimmoc scihte latipsoh eht yb devorppa saw yduts ehT .nosrep yhtlaeh a yb dedivorp saw elpmas doolb namuH .ytisrevinU nahuW fo latipsoH s'elpoeP eht ta stneitap morf deniatbo erew selpmas romut hcamots dna romut noloc ,romut revil ,romut tsaerb namuH .ytisrevinU nahuW fo latipsoH s'elpoeP eht ni snoitroba latnedicca morf deniatbo saw sutef namuh yhtlaeh dlo htnom-3 .seussit namuH

eneg 1ACRB fo secneuqes ANDc ezis tnereffid eht deniatnoc senolc evitisop 21 eseht taht dewohs sisylana ecneuqeS .sremirp retomorp 6PS dna retomorp 7T yb decneuqes erew senolc evitisop 21 .)2 .giF( detceted erew stnemgarf ngierof tnereffid htiw senolc evitisop emos ,sisylana gnicneuqes rof senolc evitisop eht neercs ot desu saw RCP nehW .rotcev T-MEGp otni denolc erew stcudorp RCP-TR ehT .)1 .giF( ecneuqes ANDc 1ACRB epyt-dliw gnidnopserroc fo taht naht retrohs yrev saw hcihw ,gnol bk 0.1 tuoba ylno saw tnemgarf AND deifilpma eht ,RCP-TR fo esruoc eht nI .31 noxe ni noiger gnidocne htgnel lluf 1ACRB fo tn ht3044 eht ta detis saw )'3-GTACCCT CGGTCGGAAGATTGTCG-'5( PR remirp esrever eht elihw ,a1 noxe ni )08641U :rebmuN knabneG( ecneuqes ANDc 1ACRB epyt-dliw eht fo tn ht83 eht ta detacol saw )'3-GG GTCAATAGACTCTTTGGG-'5( PF remirp drawrof ehT .03 -57-RZ enil llec recnac tsaerb morf ecneuqes ANDc 1ACRB fo )31-1 :snoxe( trap '5 eht etalosi ot tuo deirrac saw RCP-TR
stluseR

.)nahuW ,CCTCC( noitcelloC erutluC epyT rof retneC anihC morf deniatbo erew takruJ dna LEH ,9H ,CIH ,ALH ,aleH ,265K senil llec namuh ehT .03-57-RZ sa llew sa ,CCTA morf desahcrup saw dna erutluc MEM ni nworg saw S534-BM-ADM enil llec recnac tsaerB .2OC %5 htiw rotabucni deifidimuh a ni Co73 ta detabucni erew slleC .lm/g 001 nicymotperts dna lm/stinu 001 nillicipma htiw detnemelppus SCF %01 deniatnoc aidem erutluc ehT .)MEM( muidem laitnesse laminim ni nworg erew )4051-LRC :CCTA morf desahcruP( amonicrac latcud gnitartlifni htiw nemow orgeN lasuaponemerp dlo -raey-74 a morf detanigiro sllec 03-57-RZ .erutluc llec dna slleC
sdohteM dna slairetaM

.tnegaer )amgiS ,BAD( enidiznebonimaid yb delaever saw noitcaer roloc ehT .ydobitna yradnoces eht sa )ygolonhcetoiB gniynaS ,0001 : 1( GgI tibbar-itna dna ydobitna yramirp eht sa )macbA ,1419BA( ydobitna lanolcylop 1ACRB lanimret-C tibbar gnisu yb detceted saw snietorp tnairav ecilps 1ACRB fo noisserpxe ehT .sisylana gnittolb nretsew rof enarbmem esolullecortin ot derrefsnart dna EGAP -SDS %21 ot detcejbus erew selpmas ehT .derutaned dna setalp eht morf detcelloc erew sllec 03-57-RZ .sisylana gnittolb nretseW .margorp NAMAND htiw tuo deirrac saw )ASM( tnemngila ecneuqes elpitluM .erawtfos rnureneG htiw demrofrep saw sisylana ecneuqeS .sremirp retomorp 6PS dna 7T lasrevinu eht htiw decneuqes erew senolc evitisop fo tol A .rotcev ysae T-MEGp otni denolc erew stcudorp deifirup eht dna )ASU ,agemO( tiK noitcartxE leG gnisu siserohportcele leg retfa deifirup erew 03-57-RZ enil llec tsaerb morf stcudorp RCP-TR ehT .sisylana ecneuqeS dna gninolC .ecneuqes ANDc 1ACRB epyt-dliw eht ot gnidrocca dezisehtnys dna dengised erew yehT .)1 elbaT( PR dna PF erew RCP-TR rof sremirp ehT .snim 01 rof Co27 htiw gnidne ,)s021 rof Co27 ,s54 rof Co55 ,s04 rof Co49( noitacifilpma fo selcyc 42 dna )s 021 rof Co27 ,s 54 rof Co26-25 ,s 04 rof Co49( noitacifilpma fo selcyc 01 neht ,nim 5 rof Co49 :swollof sa demrofrep saw noitcaer RCP .etalpmet sa desu saw ANDc dnarts tsrif eht fo %01 .rerutcafunam eht yb dednemmocer snoitidnoc eht rednu Td ogilo dna )negortivnI( esatpircsnart esrever -HesaNR II tpircsrepus eht htiw ANDc dnarts tsrif eht ezisehtnys ot desu saw ANR latot fo g 5 tuobA .)ENEG( metsyS gnigamI leG yb dedrocer

.noitnevretni cituepareht rof stegrat sa elbatius snegitna romut dna srekramoib citsongorp ro citsongaid fo yrevocsid eht rof ecruos levon a edivorp lliw smrof ecilps cificeps-recnac fo noitacifitnedi eht ,suhT .recnac nairavo ro/dna tsaerb fo sisenegiromut eht ni elor tnatropmi na syalp ylbissop 1ACRB fo gnicilps evitanretla taht dezisehtopyh eW .stnairav ecilps fo rebmun a yldetcepxenu evah yam 1ACRB eneg detaicossa recnac tsaerb taht detseggus stluser esehT .level nietorp eht ta enil llec 03-57-RZ ni desserpxe erew stnairav ecilps 1ACRB emos taht detacidni sisylana tolb nretseW .emarf gnidaer lanigiro eht tpek llits stnairav ecilps 1ACRB fo tsoM .dohtem RCP -TR yb 03-57-RZ enil llec recnac tsaerb morf deziretcarahc erew smrof ecilps 1ACRB enin ,yduts tnerruc eht nI .)5002 ,.la te ,nitroF ;4002 ,notsgniviL dna ymahSlE ;7991 ,.la te ,nosliW( slevel tnereffid eht ta )SIRI-1ACRB dna b111ACRB ,1ACRB epyt-dliw( deifitnedi neeb evah stnairav ecilps evitanretla 1ACRB fo stcudorp nietorp eerht ylno ,raf suhT .snoitcnuf rieht dna eneg 1ACRB fo stnairav ecilps evitanretla eht ot noitnetta yap stroper wef a dna ,)6991 ,.la te ,uL( eneg
61

.la te aixiL oaiM

.seditoelcun nortni ot gnidnopserroc era srettel llams eht elihw ,seditoelcun noxe era srettel latipac ehT .senil gnitcennoc der yb nwohs era snoxe gnissim eht dna snoxe tnereffid ot dednopserroc srebmuN .levon erew )b11E + 01E + 2E-leD :51F ;b11E + GAC-leD :21,9F ;b11E + 01E + 9E + GAAATG-leD :8F ;b11E + 3E-leD :7F ;b11E + 01E + 9E + GAC + 2E-leD :6F( smrof ecilps eviF .03-57 -RZ enil llec recnac tsaerb morf denolc smrof ecilps 1ACRB enin dna 31-1 snoxe 1ACRB epyt-dliw eht fo spam larutcurts ehT
.3 .giF

,2F( senolc evitisop eerhT .503700-MN ni detroper osla saw etis gnicilps evitanretla fo dnik sihT .gnicilps evitanretla '5 fo msinahcem ralucelom eht yb )b11 noxe demaN( 11 noxe fo trap '3 tsegral eht osla tub ,gnippiks noxe fo msinahcem ralucelom eht yb 01-9 snoxe ylno ton deteled enolc evitisop 1F .detceted erew eneg 1ACRB fo setis ecilps levon lareves dna

,gnicilps evitanretla '5 eht yb a1 noxe fo GAAATG seditoelcun 6 tsal eht deteled llits enolc evitisop 8F .b11 noxe dna 3 noxe htob dekcal enolc evitisop 7F .gnicilps evitanretla '3 fo msinahcem ralucelom eht yb 8 noxe fo GAC seditoelcun 3+ eht deteled osla dna ,b11 dna 01 ,9 ,2 noxe dekcal enolc evitisop 6F taht dewohs sisylana ecneuqeS .2.403700-MN tnairav 1ACRB eht ni detneserp osla saw hcihw fo etis ecilps eht ,b11 noxe deteled ylno dna noitagitsevni ruo morf smrof 1ACRB detalosi lla fo tuo tnairav tsegnol eht saw enolc evitisop 4F .1.814270CB tnairav 1ACRB detroper eht fo taht htiw tnetsisnoc saw etis ecilps fo dnik sihT .gnicilps evitanretla '5 fo msinahcem ralucelom eht yb b11 noxe eritne dna a1 noxe fo GAAATG seditoelcun 6 tsal eht deteled )41F dna 5F

.RCP-TR fo stcudorp deifilpma eht :2 enaL ;RCP-TR fo lortnoc evitagen eht :1 enaL ;reddal AND bk 1 :M enaL .1ACRB eneg detaicossa recnac tsaerb fo 31-1 snoxe gniyfilpma rof tluser RCP-TR
.1 .giF

.reddal AND bk 1 :M enaL ;lortnoc evitisop eht :P enaL ;ylevitcepser ,51-1F senolc evitagen dna evitisop tnereffid eht :51-1 senaL .dohtem RCP yb 31-1 snoxe 1ACRB fo senolc evitisop eht gnineercS

.2 .giF

71

eniL lleC recnaC tsaerB morf 1ACRB eneG detaicossA recnaC tsaerB fo gnicilpS evitanretlA

.secneuqes noxe fo strap gnissim eht wohs stoD .1ACRB eneg detaicossa recnac tsaerb fo 31 -1 snoxe gnidocne )6F dna 51F ,8F ,1F ,01F ,21F ,9F ,7F ,41F ,5F ,2F ,4F( senolc evitisop 21 fo tnemngila ecneuqes elpitluM
.4 .giF

.la te aixiL oaiM

81

eb ot noitcnuf ralullec laicurc dna tnatropmi emos evah stnairav ecilps eseht taht stseggus hcihw ,spuorg lareves yb level nietorp eht ta detneserp dna detceted erew stnairav emos dna nietorp eht fo emarf gnidaer lanigiro eht tpek stnairav ecilps eseht tsom ,noitcnuf reporp rieht fo egdelwonk eht tuohtiw smrofosi ANRm 1ACRB detceted eht fo ecnacifingis dna elor eht ssessa ot tluciffid saw ti hguohtlA .noitanimret ylrae htiw mrof ecilps 51F rof tpecxe ,eneg 1ACRB epyt -dliw eht fo emarf gnidaer nepo lanigiro eht tpek llits senolc 11 deniamer eht lla ,revoeroM .levon erew hcihw fo evif ,03-57-RZ enil llec recnac tsaerb morf smrof ecilps 1ACRB enin deifitnedi dna detalosi ew ,ereH .)4002 ,notsgniviL dna ymahSlE( )tpircsnart gniniatnoc-A31 noxe 1ACRB dna SIRI -1ACRB( detceted neeb evah stnairav ecilps levon rehto owt ,yltneceR .)3002 ,halO dna nabrO( snoitidnoc tnereffid rednu ,seussit fo yteirav a ni desserpxe erew - stnairav )b11,01,9( eht dna )b11( ,)01,9( eht ,htgnel lluf eht - stnairav ecilps tnanimoderp dellac stnairav ANRm ruof taht demialc seiduts lareveS .nietorp lanoitcnuf a rof edoc ot ytilibissop eht gnivah emarf gnidaer nepo lanigiro eht deniatniam hcihw fo tsom ,)3002 ,halO dna nabrO( raf os deifitnedi neeb evah stnairav ecilps ANRm tcnitsid ytriht naht eroM .snrettap noisserpxe tnereffid ylbakramer htiw ,sepyt llec dna seussit tnereffid ni tneserp stnairav ecilps fo rebmun egral a era ereht taht gnitacidni derehtag erew secnedive erom dna erom ,eneg 1ACRB beht fo nrettap noisserpxe eht gninimaxe yB .)5002 ,nosredneH dna uA ;4002 ,enaL ;3002 ,.la te ,gniK ;2002 ,namaratikneV ;0002 ,.la te ,ujaragnahT ;3002 ,.la te ,nniuQ ;5991 ,.la te ,retsooW ;4991 ,.la te ,ikiM( noitcnuf sti dnatsrednu ot nekatrednu neeb evah seiduts suoremun ,etad taht morf dna ,4991 ni denolc saw ,eneg rosreppus ruomut a ,eneg 1ACRB ehT .)1002 ,yelevarG( ytisrevid citeneg fo ecruos tnatropmi na sa detpecca ylediw saw dna )8991 ,zepoL( noitaluger eneg fo level tnatropmi yrev a eb ot dnuof saw gnicilps evitanretla ,detseggus tsrif saw ecneserp sti ecniS

noissucsiD
.6 .giF ni detneserp yltnedive saw seussit dna senil llec namuh morf noisserpxe fo ecnereffid ehT .stnairav gnicilps eseht fo noisserpxe eht yfitnauq ylpmis ot demrofrep saw RCP evitatitnauqimes ,tnemirepxe siht nI .demrifnoc eb ot seititnauq elpmas dna seussit fo sdnik erom dedeen hcihw ,b11 noxe deteled stpircsnart wen eseht desserpxe yldrah erew seussit lamron dna romut namuh taht demees tI .selpmas sutef namuh dna takruJ ,9H ,CIH ,ALH ,aleH ,265K ,S534-BM-ADM ,03-57-RZ ni eneg 1ACRB fo stpircsnart wen eseht fo ecneserp eht demrifnoc eW .htgnel bk 1 tuoba htiw dnab AND kaew eht dewohs senil llec CIH dna takruJ ,noitidda nI .)hcamots dna noloc ,revil ,tsaerb( seussit romut ruof dna elpmas doolb namuh ,senil llec LEH ni detceted eb ton saw dnab AND siht tub ,03-57-RZ enil llec recnac tsaerb sa llew sa dnab AND bk 1 gnots a detneserp sutef namuh dna )9H dna ALH ,aleH ,265K ,S534-BM-ADM(
91

senil llec tsom ,6.giF ni nwohs sA .)hcamots dna noloc ,revil ,tsaerB( seussit romut ruof dna doolb htlaeh a ,sutef namuh shtnom-3 a ,)takruJ dna LEH ,9H ,CIH ,ALH ,aleH ,265K ,S534-BM-ADM ,03-57-RZ( senil llec namuh enin morf selpmas ANDc no tuo deirrac saw sisylana RCP-TR .level ANR eht ta eneg 1ACRB fo gnicilps evitanretla eht htiw tnetsisnoc saw hcihw ,level nietorp eht ta derrucco 1ACRB fo stnairav ecilps larutan eht taht demrifnoc tluser ehT .)5 .giF( nietorp 1ACRB epyt-dliw eht fo taht naht rewol saw hcihw fo ezis eht ,stnairav ecilps 1ACRB emos desserpxe enil llec 03-57-RZ taht delaever snoitidnoc gnicuder rednu sisylana gnittolb nretseW .ydobitna lanolcylop 1ACRB tibbar cificeps eht gnizilitu demrofrep saw gnittolb nretsew ,stnairav ecilps 1ACRB fo noisserpxe eht etagitsevni rehtruf ot redro nI .a11 noxe fo seditoelcun 9+ eht ta detis saw AGT nodoc lanimret sti dna ,01 noxe fo seditoelcun 67 gniteled fo esuaceb ,detanimret ylrae saw tnairav ecilps 51F .noiger gnidoc 01-9 snoxe fo seudiser aa 14 dna noiger gnidoc 3-2 snoxe fo seudiser aa 74 maertspu eht deteled tnairav siht os dna ,seudiser aa 14 neve gnidocne rof 01-9 snoxe deteled eht fo esuaceb FRO epyt-dliw eht deniatniam llits tnairav ecilps 6F .2 noxe fo gnissim eht morf gnitluser ,5 noxe fo editoelcun 8+ eht ta detacol saw tnairav 51F dna tnairav 6F fo GTA nodoc laitini lanoitalsnart eht taht dewohs sisylana ecneuqeS .)11 noxe fo AGT seditoelcun 9+ eht( sunimret ylrae htiw tnairav ecilps 51F rof tpecxe ,eneg 1ACRB epyt-dliw eht fo emarf gnidaer nepo lanigiro eht tpek llits senolc evitisop 11 rehto eht llA .elur GA-TG htiw dedrocca smrof ecilps esehT .gnicilps evitanretla fo setis eht dellortnoc msinahcem laiceps taht detacidni ylbissop hcihw ,8 noxe fo GAC seditoelcun 3+ eht ni detcelloc saw etis gnicilps evitanretla '3 eht elihw ,a1 noxe fo GAAATG seditoelcun 6 tsal eht no desucof ylniam saw etis gnicilps evitanretla '5 ehT .01-9 snoxe dna 3-2 snoxe ni detcelloc erew gnippiks noxe fo strap ehT .1ACRB fo snoxe 42 eht fo )seditoelcun 6543( noxe tsegnol eht saw hcihw ,gnicilps evitanretla '5 fo msinahcem ralucelom eht yb b11 noxe deteled smrof ecilps enin eseht llA .)b11E + GAC + GAAATG-leD :01F ;b11E -leD :4F ;b11E + GAAATG-leD :41,5,2F ;b11E + 01E + 9E-leD :1F( smrof ecilps ruof rof tpecxe levon erew hcihw fo )b11E + 01E + 2E-leD :51F ;b11E + GAC-leD :21,9F ;b11E + 01E + 9E + GAAATG-leD :8F ;b11E + 3E-leD :7F ;b11E + 01E + 9E + GAC + 2E-leD :6F( smrof ecilps evif ,03-57-RZ enil llec recnac tsaerb eht morf deifitnedi dna detceted erew eneg 1ACRB fo smrof ecilps fo sdnik enin ,4 .giF ni nwohs sA .4 .giF dna 3 .giF ni nwohs erew sesylana ecneuqes fo stluser eseht llA .eneg 1ACRB epyt-dliw eht fo ecneuqes ANDc eht htiw derapmoc ,snoitatum fo tol a detneserp stnairav ecilps eseht lla ,yllanoitiddA .b11 dna 01 ,2 snoxe eerht deteled enolc evitisop 51F .1.516580CB ecneuqes 1ACRB eht ot ralimis saw enolc evitisop 01F fo etis ecilps ehT .8 noxe fo GAC seditoelcun 3+ eht dna a1 noxe fo GAAATG seditoelcun 6 tsal eht htob dessim enolc evitisop 01F ,b11 noxe sediseB .tnairav 4F fo sisab eht ta 8 noxe fo GAC seditoelcun 3+ eht deteled senolc evitisop 21F dna 9F .enolc 1F htiw derapmoc

eniL lleC recnaC tsaerB morf 1ACRB eneG detaicossA recnaC tsaerB fo gnicilpS evitanretlA

.BEN morf reddaL AND goL-2 saw reddal AND .seussit dna senil llec namuh morf 1ACRB eneg detaicossa recnac tsaerb fo 31-1 snoxe gniyfilpma rof sisylana RCP-TR evitatitnauq flaH
.6 .giF

fo noitarreba taht dnuof neeb osla dah tI .yravo eht dna tsaerb eht ni ylevisulcxe tsomla noitamrof romut ot dael eneg a hcus fo snoitcnuflam eht yhw raelc ton llits saw ti dna ,)3002 ,.la te ,nniuQ ;0002 ,.la te ,ujaragnahT( sisotpopa llec ni dna )4002 ,enaL( sessecorp noitanibmocer ni ,riaper AND ni ,noitavitca lanoitpircsnart ni selor dedulcni nietorp 1ACRB htgnel lluf eht rof debircsed neeb raf os evah taht snoitcnuf llA .gnicilps evitanretla fo msinahcem ralucelom eht gnihcraeser rof eneg etadidnac doog a eb dluohs eneg 1ACRB ,suhT .sllec dna seussit tnereffid ni deifitnedi eb ot gnicilps evitanretla fo msinahcem ralucelom eht morf detluser smrofosi ANDc 1ACRB fo rebmun egral a tsixe dluoc ereht ,)4991 ,.la te ,ikiM( AND cimoneg fo bk 001 ylhguor revo detubirtsid dna snoxe gnidoc 22 fo desopmoc saw eneg 1ACRB epyt-dliw eht ecniS .detadicule

nosaer eht taht thguoht eW .recnac tsaerb ni nietorp 1ACRB fo noitazilacol ralullec eht gninrecnoc etabed gniogno na llits saw ereht ,ylraelC .)9991 ,.la te ,nosliW( suelcun eht otni gnitanigavni muluciter cimsalpodne dna msalpotyc fo metsys ekil-lennahc a htiw detaicossa osla tub suelcun eht ni nrettap ekil tod a ni ylno ton tneserp saw 1ACRB taht detroper osla saw tI .)3002 ,.la te ,nobmahC( denimaxe sllec fo epyt eht dna ,desu noitartnecnoc dna ydobitna fo epyt eht fo evitcepserri ,snoitidnoc lacimehcotsihonummi eht no tnedneped ylhgih saw noitazilacol nietorp 1ACRB taht dedulcnoc nobmahC .detceted saw gniniats nietorp 1ACRB cimsalpotyc dna raelcun htob ,senil llec tsaerb namuh no snoitidnoc lacinhcet tnereffid rednu seidobitna lanolcylop ro lanolconom lareves gnisU .)6991 ,.la te ,yllucS( epyt llec fo sseldrager nietorp raelcun a ylevisulcxe saw 1ACRB taht dnuof yllucS ,tsartnoc nI .)5991 ,.la te ,nehC( sllec recnac nairavo dna tsaerb ni msalpotyc eht ni detacol yltnarreba saw nietorp eht saerehw ,sllec lamron ni nietorp raelcun a saw 1ACRB taht detroper .la te nehC .)1002 ,halO dna nabrO( sisenegiromut nairavo dna tsaerb htiw detaicossa eb thgim syawhtap hcus fo ecnabrutsid eht dna ,enil llec aimeakuel eht htiw derapmoc sa gnicilps evitanretla ni syawhtap yrotaluger nommoc emos erahs thgim sllec nairavo eht dna tsaerb eht taht detacidni stnairav 1ACRB fo nrettap noisserpxe tnedneped enil llec ehT .)1002 ,halO dna nabrO( sisenegiromut htiw detaicossa eb yam tnairav siht fo esaerced lanoitroporp eht taht detapicitna senil llec denimaxe eht fo yna ni naht rehgih yltnacifingis saw sllec tsaerb lamron ni smrofosi rehto eht ot derapmoc tnairav 1ACRB htgnel lluf eht fo noitroporp taht noitavresbo eht ,tcaf nI .recnac tsaerb fo tnempoleved eht dnatsrednu ot lativ eb thgim snoitcnuf rieht dna 1ACRB fo stnairav ANRm eht no seidutS .)3002 ,repooC dna onitsuaF ;1002 ,yelevarG( tnempoleved recnac rof esuac tnatropmi eht fo eno saw noitatum cimoneg tuohtiw gnicilps evitanretla

.03-57-RZ enil llec recnac tsaerb eht fo setasyl eht :2 dna 1 ;roloc htiw rekram nietorp thgiew ralucelom elddiM :M .03-57-RZ morf stnairav ecilps 1ACRB fo noisserpxe eht rof gnittolb nretseW
.5 .giF

.la te aixiL oaiM

02

tsaerb devired-romut dna tnangilamnon ni desserpxe 1ACRB fo stnairav ecilps ANR regnessem lanoitcnuf fo noitaziretcarahC )6991( .A .B ,kcirrA dna .N .C ,eloC ,.D .S ,neznoC ,.M ,uL .503-972 ,23 .teneG .veR .unnA .noitaluger fo smsinahcem dna secneuqesnoc latnempoleved :ANRm-erp fo gnicilps evitanretlA )8991( .J .A ,zepoL .335-825 ,3 .rehT .loiB recnaC .noitpircsnart dna 1ACRB )4002( .F .T ,enaL .646-346 ,203 ecneicS .2ACRB dna 1ACRB ni snoitatum detirehni ot eud sksir recnac nairavo dna tsaerB )3002( .B .J ,llednaM dna .H .J ,skraM ,.C .M ,gniK .753-243 ,24 recnaC semosomorhC seneG .recnac ni gnicilps ANRm-erp fo snoitaretlA )5002( .A ,eniL dna .K ,aniliS ,.P ,nikayaZ ,.Z ,aninlaK .701-001 ,71 .teneG .sdnerT .dlrow cimoetorp eht ni ytisrevid gnisaercni :gnicilps evitanretlA )1002( .R .B ,yelevarG .645-535 ,22 .lonhcetoiB .taN .ypareht dna esaesid ni gnicilps evitanretlA )4002( .L .E ,adsaL dna .P .A ,kainaraB ,.A .M ,ocnalB-aicraG .56-75 ,1371 .atcA .syhpoiB .mihcoiB .noxe emarf-ni lanoitidda na gniniatnoc 1ACRB fo tnairav ecilps evitanretla wen A )5002( .J ,dramiS dna .P ,reyoV ,.L ,rehcnevorP ,.M ,etnalP ,.R ,ettehciP ,.B ,ecnarepseL ,.J ,enipeL ,.R ,esiobmarfaL ,.J ,etteuqihC ,.P ,egdirB ,.P ,ettesseB ,.F ,rehcoruD ,.Y ,eirbaL ,.G ,cnalbeL ,.M ,tnomuD ,.M .A ,nasioM ,.J ,nitroF .734-914 ,71 .veD .seneG .esaesid namuh dna gnicilps ANRm-erP )3002( .A .T ,repooC dna .A .N ,onitsuaF .769 -459 ,6 .loiB lleC .taN .tcudorp sucol 1ACRB a ,SIRI-1ACRB fo noitacifitnedI )4002( .M .D ,notsgniviL dna .M .W ,ymahSlE .197-987 ,072 ecneicS .recnac tsaerb ni 1ACRB fo noitazilacol ralullecbus tnarrebA )5991( .H .W ,eeL dna .K .C ,enrobsO ,.D ,ffoH noV ,.L .P ,nehC ,.C .D ,derllA ,.J .D ,yeliR ,.F .C ,nehC ,.Y ,nehC .911-701 ,97 .taerT .seR .recnaC tsaerB .sllec recnac tsaerb namuh ni nietorp 1ACRB fo noitazilacoL )3002( .F ,nongiV dna .P ,regoR ,.M ,sezielG ,.P ,edriN ,.M ,nobmahC .633-192 ,27 .mehcoiB .veR .unnA .gnicilps ANR regnessem-erp evitanretla fo smsinahceM )3002( .L .D ,kcalB .1007-3996 ,082 .mehC .loiB .J .icof raelcun decudni-noitaidar gnizinoi ot 1ACRB gnitegrat ni etarepooc sniamod TCRB dna GNIR 1ACRB ehT )5002( .R .B ,nosredneH dna .W .W ,uA

secnerefeR
.)4-004503AKD4002 :rebmuN( anihC fo margorP tnempoleveD ytilicaF dna erutcurtsarfnI D&R morf stnarg eht yb detroppus saw krow sihT stnemgdelwonkcA .sllec recnac tsaerb ni stnairav ecilps 1ACRB fo srebmun egral fo ecnetsixe eht ot eud ylbissop saw nietorp 1ACRB fo noitazilacol ralullec eht gninrecnoc etabed gniogno rof

.297-987 ,873 erutaN .2ACRB eneg ytilibitpecsus recnac tsaerb eht fo noitacifitnedI )5991( .G ,melkciM dna .C ,sbmuG ,.S ,yrogerG ,.N ,snilloC ,.J ,noignaM ,.S ,laeS ,.S ,tfiwS ,.J ,retsacnaL ,.G ,llengiB ,.R ,retsooW .042-632 ,12 .teneG .taN .samonicrac tsaerb detirehni-non ,edarg-hgih ni ssol sti dna 1ACRB namuh fo noitazilacoL )9991( .J .D ,nomalS dna .J .F ,enozlaC ,.S ,nehoC ,.H .M ,retnaK ,.H .R ,hcuZ ,.D ,notsgniviL ,.R ,yllucS ,.J .J ,nehC ,.B ,nalraK ,.K ,ekralC ,.F .M ,sserP ,.H .K ,srednA ,.R .M ,ronesalliV ,.L ,somaR ,.A .C ,nosliW .61-1 ,41 enegocnO .b11atled-1ACRB tnairav ecilps eht dna 1ACRB fo yticixot lacigoloib dna noisserpxe ,noitazilacol ralullecbus laitnereffiD )7991( .J .F ,enozlaC dna .J .D ,nomalS ,.M .D ,eseeR ,.L ,somaR ,.D ,snahssorG ,.E .E ,silujaC ,.W .F ,saauB ,.S .G ,ttoillE ,.N .M ,notyaP ,.A .C ,nosliW .281-171 ,801 lleC .2ACRB dna 1ACRB fo snoitcnuf eht dna ytilibitpecsus recnaC )2002( .R .A ,namaratikneV .69433-78433 ,572 .mehC .loiB .J .senil llec recnac nairavo dna tsaerb ni sisotpopa decudni-sserts setatilicaf 1ACRB )0002( .J .F ,hcuoC dna .H .S ,nnamfuaK ,.M ,ujaragnahT .733-333 ,21 .teneG .taN .sderdnik deknil-q31 emosomorhc ni snoitatum dna eneg 2ACRB etelpmoc ehT )6991( .E .D ,ragdloG dna .A ,bmaK ,.B ,rebeW ,.H .M ,kcinlokS ,.F ,eirbaL ,.M ,tnahcnarT ,.L ,thgirblA -nonnaC ,.E .J ,drojfyE ,.H ,ayuzihS ,.K .A ,gnoW ,.J ,suahdleF -revaeW ,.M ,tnahcnarT ,.T ,narT ,.A ,samohT ,.D ,gneT ,.J ,esnewS ,.B ,dnuldewS ,.C ,puortS ,.M ,wollefgnirtS ,.L ,eleetS ,.C .S ,redynS ,.M ,redeorhcS ,.C ,nosmaS ,.Y ,gneP ,.K ,neyugN ,.J ,nosirroM-ruhtrAcM ,.T .J ,llehctiM ,.F .J ,cnalbeL ,.R ,rerheK ,.P ,gnaiJ ,.T ,ikcenaJ ,.S ,itapalummaJ ,.T ,reittaH ,.C ,eyrF ,.M ,tnomuD ,.T ,sivaD ,.Q ,nehC ,.R ,nedgoB ,.S ,yrreB ,.R ,lleB ,.C ,regnaleB ,.D ,tennoyL-appotS ,.K ,tiffO ,.S ,suicalrohT ,.S ,revjareM ,.S ,nesuahueN ,.D ,snediE -kcuttahS ,.F ,hcuoC ,.J ,snemmoR ,.J ,dramiS ,.V .S ,naigitvaT .621-321 ,272 ecneicS .sllec recnac nairavo dna tsaerb namuh ni 1ACRB fo noitacoL )6991( .M .D ,notsgniviL dna .S ,ttinhcS ,.J ,nuetnueF ,.A .S ,artsinnaC ,.A .J ,oirpaC eD ,.M ,nworB ,.S ,nasenaG ,.R ,yllucS .8226-1226 ,36 .seR recnaC .sisotpopa decudni-yparehtomehc fo rotaludom laitnereffid a sa snoitcnuf 1ACRB )3002( .P .D ,nikraH dna .G .P ,notsnhoJ ,.M ,ytraC ,.M .P ,eromliG ,.B .P ,nalluM ,.D .R ,ydenneK ,.E .J ,nniuQ .791-191 ,65 .lohtaP .loM .gnicilps evitanretla 1ACRB fo selor gnigremE )3002( .E ,halO dna .I .T ,nabrO .83-23 ,082 .nummoC .seR .syhpoiB .mehcoiB .senil llec romut dezinorhcnys S/1G ni dna suonorhcnysa ni stnairav ecilps 1ACRB fo seliforp noisserpxE )1002( .E ,halO dna .I .T ,nabrO .17-66 ,662 ecneicS .1ACRB eneg ytilibitpecsus recnac nairavo dna tsaerb eht rof etadidnac gnorts A )4991( .la te dna .W ,gniD ,.M .L ,ttenneB ,.C ,narhcoC ,.Q ,uiL ,.S ,naigitvaT ,.K ,namhsraH ,.A .P ,laertuF ,.D ,snediE-kcuttahS ,.J ,nesnewS ,.Y ,ikiM .1854-8754 ,65 .seR .recnaC .sllec
12

eniL lleC recnaC tsaerB morf 1ACRB eneG detaicossA recnaC tsaerB fo gnicilpS evitanretlA

EXHIBIT 7

[CANCER RESEARCH 59, 2546 ­2550, June 1, 1999]

Advances in Brief

Increased Level of Exon 12 Alternatively Spliced BRCA2 Transcripts in Tumor Breast Tissue Compared with Normal Tissue1
Ivan Bieche and Rosette Lidereau2 `
Laboratoire d'Oncogenetique, Centre Rene Huguenin, F-92211 St-Cloud [I. B., R. L.]; and Laboratoire de Genetique Moleculaire, Faculte des Sciences Pharmaceutiques et ´´ ´ ´´ ´ ´ Biologiques de Paris, F-75006 Paris [I. B.], France

Abstract
The breast cancer susceptibility gene BRCA2 is expressed in a wide range of tissues as an 11-kb mRNA transcript encoding a 3418-amino acid protein, which is involved in the response to DNA damage. To obtain a better molecular characterization of BRCA2 expression in breast tissue, we analyzed full-length BRCA2 mRNA by means of reverse transcriptasePCR with a panel of primer pairs encompassing the entire cDNA sequence. We report the identification of an exon 12 alternatively spliced BRCA2 transcript ( 12-BRCA2) in normal human breast tissue, in a wide variety of other normal human tissues, and in several mouse tissues. The deletion observed in this transcript (96 bp) preserves the open reading frame, and translation of the transcript would result in a BRCA2 isoform lacking 32 amino acids between codons 2280 and 2311. The analysis of matched normal and primary tumor breast tissues from 12 patients showed that the expression level of the 12-BRCA2 transcript was higher in 4 of 12 (33%) tumor tissues compared with their normal breast tissues. Overproduction of the 12-BRCA2 variant was associated with steroid receptor-negative tumors (P 0.0005). These data suggest that the mechanisms generating the BRCA2 mRNA variant exist in normal breast tissue and may be dysregulated in steroid receptor-negative breast tumor tissues.

pairs that together encompass the entire cDNA sequence (exons 1­27). We describe here a splice variant lacking exon 12 in both normal and tumor breast tissue, the expression level of which was higher in tumor tissue than in normal breast tissue, especially in steroid receptor-negative tumors. Materials and Methods
Patients and Samples. Thirty-eight primary breast carcinomas were obtained at Center Rene Huguenin (St-Cloud, France). The samples were exam´ ined histologically for the presence of tumor cells. A tumor sample was considered suitable for this study if the proportion of tumor cells was 60%. Adjacent normal breast tissue was also taken from 12 of the 38 patients. The patients included in this study met the following criteria: primary unilateral breast carcinoma for which complete clinical, histological, and biological information was available and no other primary cancers. None of the 38 patients had received radiation therapy or chemotherapy before surgery. Seven normal breast tissue specimens obtained from women undergoing cosmetic breast surgery were used as sources of normal RNA. Total RNA from a pool of six normal human breast tissues was also purchased from Clontech (Palo Alto, CA). RNA Extraction. Total RNA was extracted from samples by the acidphenol guanidium method (13). The quality of the RNA samples was determined by electrophoresis through denaturing agarose gels and staining with ethidium bromide, and the 18S and 28S RNA bands were visualized under UV light. The yield was quantified spectrophotometrically. cDNA Synthesis. Reverse transcription was performed in a final volume of 20 l containing 1 RT3-PCR buffer [1 mM each dNTP, 5 mM MgCl2, 50 mM KCl, and 10 mM Tris-HCl (pH 8.3)], 20 units of RNase inhibitor, 50 units of Moloney murine leukemia virus RT (PE. Applied Biosystems, Foster City, CA), 2.5 M random hexamers, and 1 g of total RNA. The samples were incubated at 20°C for 10 min and 42°C for 30 min, and RT was inactivated by heating at 99°C for 5 min and cooling at 5°C for 5 min. Primers and PCR Conditions. Single-stage PCR was carried out in a final volume of 50 l containing 2 l of the RT reaction mix, 400 nM each primer, 200 M each dNTP, 1.5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1 unit of AmpliTaq DNA polymerase (PE. Applied Biosystems). The positions of the primers on the BRCA2 gene are shown in Fig. 1, and their nucleotide sequences were as follows: (a) BRC1U (113U, 5 -GTGAGGGGACAGATTTGTGA-3 ) and BRC1L (1099L, 5 -GGACATTTGGCATTGACTTT-3 ) for exons 1­10 (PCR product of 987 bp); (b) BRC2U (6974U, 5 -CCACACATTCTCTTTTTACA-3 ) and BRC2L (7939L, 5 -CCTTACCAAAATAATCTTCA-3 ) for exons 11­16 (PCR product of 966 bp); (c) BRC3U (7767U, 5 -AAAAACATCCACTCTGCCTC-3 ) and BRC3L (8776L, 5 -CCTTTTCTTCCTCTCTTTCA-3 ) for exons 15­20 (PCR product of 1010 bp); (d) BRC4U (8663U, 5 -GAGGAAATGTTGGTTGTGTTGA-3 ) and BRC4L (9508L, 5 -ACAAATAGACGAAAGGGGCA-3 ) for exons 19 ­25 (PCR product of 846 bp); (e) BRC5U (9453U, 5 -AGGATTTGTCGTTTCTGTTGT-3 ) and BRC5L (10009L, 5 -CATCAATCTCTTTCTCCCCTT-3 ) for exons 24 ­27 (PCR product of 557 bp); (f) BRC6U (983U, 5 -ACAGTGAAAACACAAATCAAAGAG-3 ) and BRC6L (7252L, 5 -GACGTTCCTTAGTTGTGCGA-3 ) for exons 9 ­13 (PCR product of 6270 bp); (g) BRC7U (7048U, 5 -GGAGAGCCCCTTATCTTAGTGG-3 ) and
3

Introduction Breast cancer, one of the most common life-threatening diseases in women, occurs in hereditary and sporadic forms. Two major breast cancer susceptibility genes, BRCA1 and BRCA2, have recently been isolated (1, 2). Both behave as classic tumor suppressor genes in familial breast cancers, in which loss of both alleles is required for the initiation of malignancy. Recent studies suggest that BRCA1 and BRCA2 proteins, by interaction with RAD51, a protein involved in the repair of double-strand DNA breaks, play a role in response to DNA damage as well as in mitotic and meiotic recombination (3). A number of germ-line mutations in the BRCA1 and BRCA2 genes have been identified in families that are prone to breast cancer (4 ­ 6) but not in sporadic breast cancers (7­9). Several laboratories are now working on the molecular characterization of BRCA1 and BRCA2 expression and function in breast cancer. The identification of a major mRNA splice variant of BRCA1 lacking the majority of exon 11 is, therefore, of considerable importance (10 ­12). The full-length BRCA1 product and the BRCA1 variant lacking exon 11 may have distinct roles in cell growth regulation and tumorigenesis (11). To obtain a better molecular characterization of BRCA2 expression, we analyzed full-length BRCA2 mRNA by using a panel of six primer
Received 1/26/99; accepted 4/16/99. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by the Comite Regional des Hauts-de-Seine de la Ligue ´´ Nationale Contre le Cancer. R. L. is a research director with the Institut National de la Sante et de la Recherche Medicale. ´ ´ 2 To whom requests for reprints should be addressed, at Laboratoire d'Oncogenetique, ´´ Centre Rene Huguenin, 35 rue Dailly, F-92211 St-Cloud, France. Phone: [phone]; ´ Fax: [phone].

The abbreviations used are: RT, reverse transcriptase; WT, wild-type.

2546

SPLICED BRCA2 TRANSCRIPTS IN BREAST CANCER

Fig. 1. Location of primer pairs used for BRCA2 gene analysis. u, known functional domains of BRCA2 protein.

BRC7L (7254L, 5 -TTGACGTTCCTTAGTTGTGCGA-3 ) for exons 11­13 (PCR product of 207 bp). Primers were chosen with the aid of the Oligo 4.0 (National Biosciences, Plymouth Meeting, MN) computer program. Primers are designated by the nucleotide position (relative to BRCA2 GenBank accession no. U43746) corresponding to the 5 position, followed by the letter U for upper (i.e., sense) strand or L for lower (i.e., antisense) strand. The PCR procedure comprised: initial denaturation at 94°C for 5 min; 32 cycles of 1 min at 94°C, 1 min at 55­ 65°C, and 1.5 min at 72°C; and a final extension step of 10 min at 72°C, using a Perkin-Elmer 9600 DNA thermocycler. Aliquots (2 l) of the appropriately diluted PCR products were added to 2.5 l of deionized formamide containing 0.3 l of a molecular size marker (Genescan 2500 ROX; PE. Applied Biosystems). The mixtures were denatured by heating and 2.5- l aliquots were loaded onto 6% polyacrylamide gels containing 8 M urea and run for 6 h at 1200 V on the Applied Biosystems model 373A DNA sequencing system (PE. Applied Biosystems). The resulting gel data were analyzed for fragment size and peak area by using the Genescan 672 Fragment Analysis software (PE. Applied Biosystems). Quantitative 12-BRCA2 Transcript Analysis. Coamplification of all BRCA2 transcripts ( 12-BRCA2 and WT BRCA2 transcripts) with the same primer pair (BRCA2U/BRCA2L) provided a quantitative competitive RT-PCR method, in which the internal control was the coamplified WT BRCA2 mRNA, and comparative expression of 12-BRCA2 and WT BRCA2 mRNA could be determined for each sample. According to Pannetier et al. (14), the ratios between these two BRCA2 transcripts were similar regardless of the number of cycles. The sensitive Applied Biosystems model 373A DNA sequencing system (PE. Applied Biosystems) was used, and the different fragments were quantified with Genescan 672 Fragment Analysis software (PE. Applied Biosystems), which calculates peak size and area. For a given sample, the final result was expressed as a proportion (P 12, in percentage) of 12-BRCA2 mRNA over all BRCA2 mRNAs, was determined as follows:

Results Identification of a Major BRCA2 Variant in Normal Human Breast Tissue. We analyzed BRCA2 mRNA expression in normal breast tissue samples by RT-PCR), using five primer pairs (BRC1U/ BRC1L­BRC5U/BRC5L) that encompass the entire cDNA sequence of full-length BRCA2, except the large exons 10 and 11 (Fig. 1). The samples comprised seven normal breast tissue specimens obtained from women undergoing cosmetic breast surgery and a pool of six normal human breast tissues. All primer pairs yielded a major RTPCR fragment that was exactly the size predicted from the published BRCA2 cDNA sequence (GenBank accession no. U43746). However, besides the expected band, the BRC2U/BRC2L primer pair yielded an additional band of smaller size ( 10% of the WT BRCA2 transcript amount; Table 1). Other primer pairs (BRC1U/BRC1L and BRC3U/ 3L) yielded abnormal bands, but at very low levels ( 3% of the WT BRCA2 transcript). Finally, primer pairs BRC4U/BRC4L and BRC5U/BRC5L did not yield additional abnormal bands. The additional band of smaller size (870 bp) than the expected band at 966 bp obtained with the BRC2U/BRC2L primer pair (exons 11­16) was observed in all of the normal breast samples examined. This smaller transcript had a 96-bp deletion, presumably resulting from exon 12 alternative splicing of the BRCA2 mRNA. PCR ampliTable 1 Proportion of 12-BRCA2 transcripts in human breast tissues Patient no. Individual normal breast tissues P1 P2 P3 P4 P5 P6 P7 Pool of six normal breast tissues Matched normal and tumor breast tissues P8 P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 P19 Normal tissue 13.2 10.5 14.1 8.9 8.6 10.1 8.6 9.1 7.2 6.6 11.8 11.1 9.8 7.3 11.4 14.7 13.2 8.1 7.7 6.0 1.2a 0.8 0.9 1.1 0.6 1.5 0.9 0.6 1.1 0.9 0.6 0.8 1.8 1.4 0.7 1.1 0.4 0.7 1.1 0.9 35.3 7.1 27.2 23.9 11.1 21.4 11.6 12.9 15.0 7.9 8.2 6.8 0.9 1.2 1.3 0.6 1.9 0.8 0.9 0.9 0.6 1.5 0.8 1.1 Tumor tissue

P 12

100

2-BRCA2 (peak area) 1 12-BRCA2 WT BRCA2 (peak areas)

The reproducibility of the quantitative measurements was evaluated by three independent replicate cDNA synthesis and PCR runs. The means of the replicated measurements and their 95% confidence intervals were calculated. Sequencing of PCR Products. PCR products were resolved in a 1.5% low-melting point agarose gel (Life Technologies, Inc., Gaithersburg, MD), stained with ethidium bromide. DNA fragments were eluted from gels and purified using the QIAquick PCR purification kit (Qiagen, Santa Clareta, CA). The purified fragments were sequenced using the ABI PRISM Dye Terminator Cycle Sequencing kit (PE. Applied Biosystems) on the Applied Biosystems model 373A DNA sequencing system (PE. Applied Biosystems). Statistical Analysis. Biological parameters were compared using the 2 test. Differences between the two populations were judged significant at confidence levels of 95% (P 0.05).

a For each sample, the mean proportion (%) of BRCA2 transcripts was calculated as the mean of the proportions found for each measurement. Triplicate cDNA and PCRs were performed for each sample. Data represent 95% confidence intervals of the means.

2547

SPLICED BRCA2 TRANSCRIPTS IN BREAST CANCER

fication with primer pair BRC7U/BRC7L, which encompasses only exon 12 (Fig. 1), and sequence analysis (Fig. 2) confirmed the existence of a splice variant lacking exon 12. Putative alternative splicing involving large exons such as exons 10 (1116-bp) and 11 (4932-bp) was studied by Northern blot analysis. This analysis showed a single 11-kb BRCA2 transcript in all samples tested (data not shown), confirming a previous study (15). However, because BRCA2 is remarkably similar to BRCA1, both having a large exon 11 (3426 bp for BRCA1 and 4932 bp for BRCA2), and because several authors have shown the existence of an mRNA variant of BRCA1 with deletion of exon 11 (10 ­12), we confirmed our Northern blot results by RT-PCR analysis using a primer pair (BRC6U/BRC6L) encompassing exons 10 and 11 of BRCA2 (Fig. 1). This primer pair not only did not yield the expected 6270-bp fragment because of the inefficiency of RT-PCR over such a length of sequence, but it also did not yield the putative 222- and 1338-bp fragments when exon 11 (with and without exon 10, respectively) had been spliced out. Detection of the 12-BRCA2 Variant in Other Normal Human Tissues. Expression of the 12-BRCA2 mRNA variant in a variety of normal human tissues, including peripheral blood leukocytes, kidney, smooth muscle, stomach, colon, skin, liver, bone marrow, ovary, placenta, and prostate, was examined. The 12-BRCA2 variant was observed in all tested tissues, with a proportion of 10%, compared with the WT BRCA2 transcript. Detection of the 12-BRCA2 Variant in Mouse Tissues. To verify the presence of the 12-BRCA2 alternative splicing variant in mouse tissues, we carried out RNA RT-PCR with primers encompassing exon 12. One transcript isoform of the expected size, comparable to the human profile (96 bp smaller than the WT BRCA2 PCR product), was amplified from all mouse tissues tested (smooth muscle, placenta, and liver). The mouse isoform showed a deletion of exactly the same 96 nucleotides of exon 12 as in the human counterpart. Increased Level of the 12-BRCA2 Variant in Tumor Breast Tissue Compared with Normal Tissue. Because BRCA2 is responsible for the development of a subset of familial breast tumors, the possible role of 12-BRCA2 alternative splicing in sporadic breast tumorigenesis warrants investigation. We examined the expression level of the 12-BRCA2 variant in tumor breast tissue compared with normal tissue. We analyzed matched normal and primary tumor breast tissues from 12 patients (patients P8 ­P19; Table 1). For each sample, three different cDNA and PCRs were performed, and the mean value was determined. To check the reliability of our molecular analysis, we used several controls: (a) triplicate PCRs were carried out, one for 30 cycles, another for 32 cycles, and the last for 35 cycles, to check whether 32 PCR cycles corresponded to the exponential phase of the reaction; (b) PCR was carried out with the two primer pairs BRC2U/BRC2L and BRC7U/BRC7L, which both reveal the 12-BRCA2 variant (Fig. 1); (c) PCR was carried out using three DNA polymerase conditions: AmpliTaq DNA polymerase (PE. Applied Biosystems), AmpliTaq DNA polymerase (PE. Applied Biosystems) plus TaqStart Antibody (Clontech), and AmpliTaq Gold DNA polymerase (PE. Applied Biosystems). These three controls were used to check whether the two PCR fragments were equally amplified. Indeed, in certain PCR conditions, smaller fragments could be more efficiently amplified than larger fragments. For each sample, the qualitative and quantitative measurements in different PCR conditions were not significantly different from each other, showing that the smaller fragments were not more efficiently amplified, therefore confirming the accuracy of the molecular analysis. Because the levels of 12-BRCA2 variant in the 12 matched normal samples, together with the 8 previously tested normal samples (7 normal breast tissue specimens obtained from women undergoing

Fig. 2. A comparison of the nucleotide sequences of WT BRCA2 and its variant lacking the entire exon 12 in human breast tissue. Corresponding amino acid sequences (in single-letter code) are shown. Loss of exon 12 generates a BRCA2 protein lacking 32 amino acids between codons 2280 and 2311.

cosmetic breast surgery and a pool of 6 normal human breast tissues), consistently fell between 6 and 15 P 12 value, values of 20 or more were considered to represent overproduction of the 12-BRCA2 variant in individual breast cancer tissue. Among the 12 patients in whom both primary breast tumors and matched normal breast tissue were investigated, 4 (P8, P10, P11, and P13; 33.3%) clearly showed a higher proportion of the 12-BRCA2 variant in tumor than in normal tissue (Table 1). Overproduction of the 12-BRCA2 Variant Is Associated with Steroid Receptor Status. BRCA2 expression is regulated by estrogen in human breast cancer cell lines (16), so it was important to determine whether a high level of 12-BRCA2 variant is associated with the steroid receptor status of the tumors. We analyzed 12-BRCA2 mRNA expression in 26 additional breast tumors selected on the basis of steroid receptor status: half (n 13) were both estrogen receptor and progesterone receptor negative and other half were both estrogen receptor and progesterone receptor positive. The level of the 12BRCA2 variant ranged from 5.9 to 41.9% in this additional series. Fig. 3 represents tumors in which the proportion of 12-BRCA2 variant was 5.9% (T444), 22.6% (T182), and 41.9% (T327). Overproduction of the 12-BRCA2 variant was found in 9 (34.6%) of these 26 tumors and was significantly associated with steroid receptor negativity (P 0.0005). None of the 13 steroid receptor-positive tumors showed overproduction of the 12-BRCA2 variant, compared to 9 of the 13 (69%) that were steroid receptor negative. Discussion Alternative mRNA splicing is a common mechanism for regulating gene expression in higher eukaryotes, and there are many examples of development-, tissue-, and tumor-specific differences in splicing events. To search systematically for the existence of alternative BRCA2 variants, we carried out RT-PCR with primer pairs covering the whole sequence. We used only a single-stage PCR strategy to avoid the overexpression of shorter PCR products frequently observed by nested PCR. It is interesting to note that Xu et al. (12), using a nested RT-PCR strategy, identified multiple variants of the BRCA1 gene. Here, we report the identification of a major alternative BRCA2 transcript with an expression level of 10% in normal breast tissue relative to the WT BRCA2 transcript. Sequencing of this alternative transcript shows that it arises from alternative splicing of exon 12. We cannot rule out the existence of other important BRCA2 variants. Indeed, we observed several BRCA2 variant transcripts in the NH2terminal and central domains (primer pairs BRC1U/BRC1L and BRC3U/BRC3L), but they had very low expression levels ( 3%) relative to the WT BRCA2 transcript (data not shown). Thus, we

2548

SPLICED BRCA2 TRANSCRIPTS IN BREAST CANCER

Fig. 3. 12-BRCA2 transcript level in three breast tumor samples. PCR products of 12-BRCA2 and WT BRCA2 cDNA give two different peaks of fluorescence. The area of each peak correlates with the amount of PCR product. Results were expressed in percentage as the ratio between the 12-BRCA2 peak area value over the sum of the two peak area values ( 12-BRCA2 and WT BRCA2). Each tumor sample was analyzed in triplicate, but the data for only one analysis are shown here. The proportions of 12-BRCA2 variant were 5.9% in tumor T444, 22.6% in T182, and 41.9% in T327.

observed the 3-BRCA2 variant reported by Siddique et al. (17). We did not find any variants in the COOH-terminal domain (exons 19 ­27; primer pairs BRC4U/BRC4L and BRC5U/BRC5L). The number of nucleotides (96 bp) missing from the 12-BRCA2 transcript isoform is a multiple of three, suggesting the maintenance of the open reading frame; translation of this transcript would result in a BRCA2 protein lacking 32 amino acids between codons 2280 and 2311. The function of this region of BRCA2 protein is unknown. Indeed, several different domains have been recognized in BRCA2. A coding sequence for a transcriptional activation domain was identified in the 5 end of the transcript (exon 3; Ref. 18) and a domain that interacts with RAD51 through its BRC repeats located at the 5 p ortion of exon 11 (19). None of these functional domains is encoded by exon 12. However, several of our results suggest that the 12BRCA2 transcript may give rise to a protein with an important biological function. (a) The 12-BRCA2 transcript was observed in a large variety of normal adult human tissues, including peripheral blood leukocytes, and it is conserved in the mouse. (b) The expression of the 12-BRCA2 transcript was higher in tumor tissue than in normal breast tissue, suggesting the existence of mechanisms generating the BRCA2 mRNA variant in normal breast tissue and the possibility that these may be dysregulated in breast tumor tissues. It is not clear why or by what mechanism the BRCA2 mRNA variant level is increased, but it could be caused by factors at the transcriptional or posttranscriptional level or both. (c) Overproduction of the 12BRCA2 variant is associated with steroid receptor-negative tumors. Spillman and Bowcock (16) have previously shown that estrogen regulates BRCA2 mRNA expression mediated by the estrogen receptor. Taken together, these results suggest that the 12-BRCA2 transcript isoform must make a significant contribution to overall BRCA2 function. In conclusion, we have identified an alternatively spliced BRCA2 transcript that is widely expressed in all normal tissues examined. This 12-BRCA2 transcript is overexpressed in steroid receptor-negative breast tumor tissue, suggesting that dysregulation of the 12-BRCA2 isoform may contribute to progression in human breast cancer. Characterization of the functional properties of the protein derivative and direct assessment of protein produced in various cell types will be

necessary to determine the significance of this variant. Alternative splicing of the BRCA2 gene in lymphocytes may also have an important practical implication: in some cases, it may complicate the detection of germ-line BRCA2 mutations based on the screening of lymphocyte RNA. Acknowledgments
We thank A. Khodja for excellent technical assistance. We also thank the Centre Rene Huguenin staff for assistance in specimen collection and patient ´ care.

References
1. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P. A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L., M., Ding, W., Bell, R., Rosenthal, J., Hussey, C., Tran, T., McClure, M., Frye, C., Hattier, T., Phelps, R., Haugen-Stano, A., Katcher, H., Yakumo, K., Gholami, Z., Shaffer, D., Stone, S., Bayer, S., Wray, C., Bogden, R., Dayananth, P., Ward, J., Tonin, P., Narod, S., Briston, P. K., Norris, F. H., Helvering, L., Morrison, P., Rosteck, P., Lai, M., Barrett, J. C., Lewis, C., Neuhausen, S., Cannon-Albright, L., Goldgar, D., Wiseman, R., Kamb, A., and Skolnick, M. H. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science (Washington DC), 266: 66 ­71, 1994. 2. Wooster, R., Bignell, G., Lancaster, J., Swift, S., Seal, S., Mangion, J., Collins, N., Gregory, S., Gumbs, C., Micklem, G., Barfoot, R., Hamoudi, R., Patel, S., Rice, C., Biggs, P., Hashim, Y., Smith, A., Connor, F., Arason, A., Gudmundsson, J., Ficenec, D., Kelsell, D., Ford, D., Tonin, P., Bishop, D. T., Spurr, N. K., Ponder, B. A. J., Eeles, R., J., Peto, P., Devilee, C., Cornelisse, C., Lyunch, H., Narod, S., Lenoir, G., Egilsson, V., Barkadottir, R. B., Easton, D. F., Bentley, D. R., Futreal, P. A., Ashworth, A., and Stratton, M. R. Identification of the breast cancer susceptibility gene BRCA2. Nature (Lond.), 378: 789 ­792, 1995. 3. Zhang, H., Tombline, G., and Weber, B. L. BRCA1, BRCA2, and DNA damage response: collision or collusion? Cell, 92: 433­ 436, 1998. 4. Shattuck-Eidens, D., McClure, M., Simard, J., Labrie, F., Narod, S., Couch, F., Hoskins, K., Weber, B., Castilla, L., Erdos, M., Brody, L., Friedman, L., Ostermeyer, E., Szabo, C., King, M. C., Jhanwar, S., Offit, K., Norton, L., Gilewski, T., Lubin, M., Osborne, M., Black, D., Boyd, M., Steel, M., Ingles, S., Haile, R., Lindblom, A., Olsson, H., Borg, A., Bishop, D. T., Solomon, E., Radice, P., Spatti, G., Gayther, S., Ponder, B., Warren, W., Stratton, M., Liu, Q., Fujimura, F., Lewis, C., Skolnick, M. H., and Goldgar, D. E. A collaborative survey of 80 mutations in the BRCA1 breast and ovarian cancer susceptibility gene. J. Am. Med. Assoc., 273: 535­541, 1995. 5. Couch, F. J., Farid, L. M., DeShano, M. L., Tavtigian, S. V., Calzone, K., Campeau, L., Peng, Y., Bogden, B., Chen, Q., Neuhausen, S., Shattuck-Eidens, D., Godwin, A. K., Daly, M., D. M., Radford, S., Sedlacek, J., Rommens Simard, J., Garber, J., Merajver, S., and Weber, B. L. BRCA2 germline mutations in male breast cancer cases and breast cancer families. Nat. Genet., 13: 123­125, 1996. 6. Phelan, C. M., Lancaster, J. M., Tonin, P., Gumbs, C., Cochran, C., Carter, R., Ghadirian, P., Perret, C., Moslehi, R., Dion, F., Faucher, M. C., Dole, K., Karimi, S., Foulkes, W., Lounis, H., Warner, E., Goss, P., Anderson, D., Larsson, C., Narod,

2549

SPLICED BRCA2 TRANSCRIPTS IN BREAST CANCER

7.

8.

9.

10.

11.

12.

S. A., and Futreal, A. P. Mutation analysis of the BRCA2 gene in 49 site-specific breast cancer families. Nat. Genet., 13: 120 ­122, 1996. Lancaster, J. M., Wooster, R., Mangion, J., Phelan, C. M., Cochran, C., Gumbs, C., Seal, S., Barfoot, R., Collins, N., Bignell, G., Patel, S., Hamoudi, R., Larsson, C., Wiseman, R. W., Berchuck, A., Dirk Iglehart, J., Stratton, M. R., and Futreal, P. A. BRCA2 mutations in primary breast and ovarian cancers. Nat. Genet., 13: 238 ­244, 1996. Miki, Y., Katagiri, T., Kasumi, F., Yoshimoto, T., and Nakamura, Y. Mutation analysis in the BRCA2 gene in primary breast cancers. Nat. Genet., 13: 245­247, 1996. Teng, D. H. F., Bogden, R., Mitchell, J., Baumgard, M., Bell, R., Berry, S., Davis, T., Ha, P. C., Kehrer, R., Jammulapati, S., Chen, Q., Offit, K., Skolnick, M. H., Tavtigian, S. V., Jhanwar, S., Swedlund, B., Wong, A. K. C., and Kamb, A. Low incidence of BRCA2 mutations in breast carcinoma and other cancers. Nat. Genet., 13: 241­244, 1996. Lu, M., Conzen, S. D., Cole, C. N., and Arrick, B. A. Characterization of functional messenger RNA splice variants of BRCA1 expression in nonmalignant and tumorderived breast cells. Cancer Res., 56: 4578 ­ 4581, 1996. Wilson, C. A., Payton, M. N., Elliot, G. S., Buaas, F. W., Cajulis, E. E., Grosshans, D., Ramos, L., Reese, D., Slamon, D. J., and Calzone, F. J. Differential subcellular localization, expression and biological toxicity of BRCA1 and the splice variant BRCA1- 11b. Oncogene, 14: 1­16, 1997. Xu, C. F., Chambers, J. A., Nicolai, H., Brown, M. A., Hujeirat, Y., Mohammed, S., Hodgson, S., Kelsell, D. P., Spurr, N. K., Bishop, D. T., and Solomon, E. Mutations and alternative splicing of the BRCA1 gene in UK breast/ovarian cancer families. Genes Chromosomes Cancer, 18: 102­110, 1997.

13. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156 ­ 159, 1987. 14. Pannetier, C., Delassus, S., Darche, S., Saucier, C., and Kourilsky, P. Quantitative titration of nucleic acids by enzymatic amplification reactions run to saturation. Nucleic Acids Res., 21: 577­583, 1993. 15. Tavtigian, S. V., Simard, J., Rommens, J., Couch, F., Shattuck-Eidens, D., Neuhausen, S., Merajver, S., Thorlacius, S., Offit, K., Stoppa-Lyonnet, D., Belanger, C., Bell, R., Berry, S., Bogden, R., Chen, Q., Davis, T., Dumont, M., Frye, C., Hattier, T., Jammulapati, S., Janecki, T., Jiang, P., Kehrer, R., Leblanc, J. F., Mitchell, J. T., McArthur-Morrison, J., Nguyen, K., Peng, Y., Samson, C., Schroeder, M., Snyder, S. C., Steele, L., Stringfellow, M., Stroup, C., Swedlund, B., Swensen, J., Teng, D., Thomas, A., Tran, T., Tranchant, M., Weaver-Feldhaus, J., Wong, A. K. C., Shizuya, H., Eyfjord, J. E., Cannon-Albright, L., F. Labrie, F., Skolnick, M. H., Weber, B., Kamb, A., and Goldgar, D. E. The complete BRCA2 gene and mutations in chromosome 13q-linked kindreds. Nat. Genet., 12: 333­337, 1996. 16. Spillman, M. A., and Bowcock, A. M. BRCA1 and BRCA2 mRNA levels are coordinately elevated in human breast cancer cells in response to estrogen. Oncogene, 13: 1639 ­1645, 1996. 17. Siddique, H., Zou, J-P. Rao, V. N., and Reddy, E. S. P. The BRCA2 is a histone acetyltransferase. Oncogene, 16: 2283­2285, 1998. 18. Milner, J., Ponder, B., Hughes-Davies, L., Seltmann, M., and Kouzarides, T. Transcriptional activation functions in BRCA2. Nature (Lond.), 386: 772­773, 1997. 19. Chen, P. L., Chen, C. F., Chen, Y., Xia, J., Sharp, D., and Lee, W. H. The BRC repeats in BRCA2 are critical for RAD51 binding and resistance to methyl methanesulfonate treatment. Proc. Natl. Acad. Sci. USA, 95: 5287­5292, 1998.

2550

EXHIBIT 8